ID: 1139344617

View in Genome Browser
Species Human (GRCh38)
Location 16:66294519-66294541
Sequence CATTTACAGAACCTATTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139344609_1139344617 29 Left 1139344609 16:66294467-66294489 CCCTGATCGGACTACGTTACTAG No data
Right 1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG No data
1139344610_1139344617 28 Left 1139344610 16:66294468-66294490 CCTGATCGGACTACGTTACTAGG No data
Right 1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG No data
1139344608_1139344617 30 Left 1139344608 16:66294466-66294488 CCCCTGATCGGACTACGTTACTA No data
Right 1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139344617 Original CRISPR CATTTACAGAACCTATTTAT GGG Intergenic
No off target data available for this crispr