ID: 1139348423

View in Genome Browser
Species Human (GRCh38)
Location 16:66320101-66320123
Sequence CCAGAATCCTCGGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139348416_1139348423 6 Left 1139348416 16:66320072-66320094 CCGCTCACTGCCCTGAGGGTGAA No data
Right 1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG No data
1139348418_1139348423 -4 Left 1139348418 16:66320082-66320104 CCCTGAGGGTGAAGTGAGGCCAG No data
Right 1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG No data
1139348411_1139348423 27 Left 1139348411 16:66320051-66320073 CCAGGAAGCTGTGACGCCAGCCC No data
Right 1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG No data
1139348412_1139348423 11 Left 1139348412 16:66320067-66320089 CCAGCCCGCTCACTGCCCTGAGG No data
Right 1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG No data
1139348415_1139348423 7 Left 1139348415 16:66320071-66320093 CCCGCTCACTGCCCTGAGGGTGA No data
Right 1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG No data
1139348419_1139348423 -5 Left 1139348419 16:66320083-66320105 CCTGAGGGTGAAGTGAGGCCAGA No data
Right 1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139348423 Original CRISPR CCAGAATCCTCGGGAAAAAC TGG Intergenic
No off target data available for this crispr