ID: 1139348537

View in Genome Browser
Species Human (GRCh38)
Location 16:66320679-66320701
Sequence TAATTAGGTTGACAGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139348537_1139348540 -5 Left 1139348537 16:66320679-66320701 CCCTGCATCTGTCAACCTAATTA No data
Right 1139348540 16:66320697-66320719 AATTACAAAATAGCTCTTCCAGG No data
1139348537_1139348543 13 Left 1139348537 16:66320679-66320701 CCCTGCATCTGTCAACCTAATTA No data
Right 1139348543 16:66320715-66320737 CCAGGCTGACTCACAGCCTTGGG No data
1139348537_1139348544 28 Left 1139348537 16:66320679-66320701 CCCTGCATCTGTCAACCTAATTA No data
Right 1139348544 16:66320730-66320752 GCCTTGGGTGATCCCAGCACAGG No data
1139348537_1139348541 12 Left 1139348537 16:66320679-66320701 CCCTGCATCTGTCAACCTAATTA No data
Right 1139348541 16:66320714-66320736 TCCAGGCTGACTCACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139348537 Original CRISPR TAATTAGGTTGACAGATGCA GGG (reversed) Intergenic
No off target data available for this crispr