ID: 1139353277

View in Genome Browser
Species Human (GRCh38)
Location 16:66351219-66351241
Sequence TGCTGGGACCCTTTATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139353277_1139353287 19 Left 1139353277 16:66351219-66351241 CCAGGAGATAAAGGGTCCCAGCA No data
Right 1139353287 16:66351261-66351283 GTCAAGGCATTCCCCCAACGGGG No data
1139353277_1139353283 -3 Left 1139353277 16:66351219-66351241 CCAGGAGATAAAGGGTCCCAGCA No data
Right 1139353283 16:66351239-66351261 GCAGTGGGGTGCAAAGCTTTAGG No data
1139353277_1139353284 3 Left 1139353277 16:66351219-66351241 CCAGGAGATAAAGGGTCCCAGCA No data
Right 1139353284 16:66351245-66351267 GGGTGCAAAGCTTTAGGTCAAGG No data
1139353277_1139353285 17 Left 1139353277 16:66351219-66351241 CCAGGAGATAAAGGGTCCCAGCA No data
Right 1139353285 16:66351259-66351281 AGGTCAAGGCATTCCCCCAACGG No data
1139353277_1139353286 18 Left 1139353277 16:66351219-66351241 CCAGGAGATAAAGGGTCCCAGCA No data
Right 1139353286 16:66351260-66351282 GGTCAAGGCATTCCCCCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139353277 Original CRISPR TGCTGGGACCCTTTATCTCC TGG (reversed) Intergenic
No off target data available for this crispr