ID: 1139355707

View in Genome Browser
Species Human (GRCh38)
Location 16:66366151-66366173
Sequence CCATTCCCACAAAGACATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139355704_1139355707 -6 Left 1139355704 16:66366134-66366156 CCTGTCACCTTTAAAGTCCATTC No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355701_1139355707 5 Left 1139355701 16:66366123-66366145 CCTGAAGCCTCCCTGTCACCTTT No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355700_1139355707 11 Left 1139355700 16:66366117-66366139 CCATCTCCTGAAGCCTCCCTGTC No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355698_1139355707 17 Left 1139355698 16:66366111-66366133 CCTTTCCCATCTCCTGAAGCCTC No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355697_1139355707 18 Left 1139355697 16:66366110-66366132 CCCTTTCCCATCTCCTGAAGCCT No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355699_1139355707 12 Left 1139355699 16:66366116-66366138 CCCATCTCCTGAAGCCTCCCTGT No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355703_1139355707 -5 Left 1139355703 16:66366133-66366155 CCCTGTCACCTTTAAAGTCCATT No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data
1139355702_1139355707 -2 Left 1139355702 16:66366130-66366152 CCTCCCTGTCACCTTTAAAGTCC No data
Right 1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139355707 Original CRISPR CCATTCCCACAAAGACATCA TGG Intergenic
No off target data available for this crispr