ID: 1139356706

View in Genome Browser
Species Human (GRCh38)
Location 16:66371197-66371219
Sequence ACTCTGTGGGGACTCTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139356706_1139356716 9 Left 1139356706 16:66371197-66371219 CCATTTGAGAGTCCCCACAGAGT 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1139356716 16:66371229-66371251 ACTGGGTCCCAGCCCCAACCTGG 0: 1
1: 0
2: 2
3: 24
4: 316
1139356706_1139356723 28 Left 1139356706 16:66371197-66371219 CCATTTGAGAGTCCCCACAGAGT 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1139356723 16:66371248-66371270 CTGGACTGAGATTTGAGCTGTGG 0: 1
1: 0
2: 2
3: 30
4: 239
1139356706_1139356714 -9 Left 1139356706 16:66371197-66371219 CCATTTGAGAGTCCCCACAGAGT 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1139356714 16:66371211-66371233 CCACAGAGTTTGGGGGTCACTGG 0: 2
1: 0
2: 0
3: 15
4: 250
1139356706_1139356715 -8 Left 1139356706 16:66371197-66371219 CCATTTGAGAGTCCCCACAGAGT 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1139356715 16:66371212-66371234 CACAGAGTTTGGGGGTCACTGGG 0: 2
1: 0
2: 0
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139356706 Original CRISPR ACTCTGTGGGGACTCTCAAA TGG (reversed) Intronic
903324031 1:22559463-22559485 ACTCTGTGAGGGGTCTCAAAGGG - Intergenic
904447980 1:30589956-30589978 ACACTGAGGGGACTCACAAATGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908433394 1:64080951-64080973 GCTGTGTGGGGATTCTCAGAGGG - Intronic
909256706 1:73432433-73432455 ATTATCTGAGGACTCTCAAAAGG - Intergenic
912786688 1:112610611-112610633 GCTCTCTGGGGTCTCTCATAAGG + Intronic
913355251 1:117913890-117913912 ACTCTCTGGAGACTCTTACAAGG - Intronic
913458615 1:119059917-119059939 ACACAGTGGGGCCTTTCAAAGGG + Intronic
914900361 1:151708207-151708229 ACTCTGTGAGGACTCTGAACTGG + Intronic
915115605 1:153597237-153597259 ACTCTGTGTGGACTGCCCAAAGG - Intergenic
917887217 1:179398547-179398569 ACTCTGTGGTGACACCCACATGG - Intronic
918442540 1:184582435-184582457 ACTAAATTGGGACTCTCAAAGGG - Intronic
919139240 1:193549846-193549868 ACACTCTGGGGCCTCTCAAAGGG - Intergenic
920217112 1:204368704-204368726 ACTCTCTTGGGTCTCTCAAAAGG - Intronic
920776189 1:208939679-208939701 AAACTGTGGAGAATCTCAAAAGG - Intergenic
921077628 1:211712583-211712605 CCTCTGTGAGAACTCTCAGAGGG - Intergenic
1064954868 10:20896647-20896669 AATCTTTGGGGGTTCTCAAATGG + Intronic
1065279789 10:24123692-24123714 AATCTGTGGAGACTCGAAAATGG + Intronic
1067517801 10:46968489-46968511 GCTCTGTGGAGACAATCAAAAGG - Intronic
1067644447 10:48083340-48083362 GCTCTGTGGAGACAATCAAAAGG + Intergenic
1068393991 10:56437596-56437618 GCTCAGTGGGGGCTTTCAAATGG - Intergenic
1072513786 10:96155720-96155742 AGTCTGTTGGGATTCTCACAGGG + Intronic
1073119311 10:101111884-101111906 TCTCTTTGGGGACCCTCCAAAGG - Intronic
1075515545 10:123105105-123105127 ACTCTGTCGGGACTGACAAAGGG + Intergenic
1083643122 11:64156357-64156379 ACTGTGTGGGCACTCCCAGACGG + Intronic
1084683569 11:70680848-70680870 TCCTTGTGGGGACTCTCAACAGG + Intronic
1085232628 11:74985813-74985835 AAACTGTGGGTACTCTCTAATGG - Intergenic
1085910576 11:80820232-80820254 ACTCTGTGGCTGCTCTCAAGAGG + Intergenic
1086724388 11:90164981-90165003 ACACACTGGGGACTTTCAAAGGG - Intronic
1097521098 12:60672222-60672244 ACTGTGTGAGGCCTCTCAATAGG - Intergenic
1098201821 12:68064200-68064222 ACTGGGTGGGGACTCTCTGAAGG - Intergenic
1103866454 12:124055746-124055768 CCTCTGTGGGGACCCTTAACAGG + Intronic
1106827825 13:33542982-33543004 ACTTTGTGGCGACTCTGAAGCGG + Intergenic
1107515073 13:41121197-41121219 ACACTGGGGGCACTCTCAAGAGG - Intergenic
1110514824 13:76397664-76397686 ACTGTGTGGGGTGGCTCAAAAGG + Intergenic
1114921840 14:27342372-27342394 ACTCAGTGGGGCCTGTCAAGGGG + Intergenic
1116386349 14:44335095-44335117 ACTCTGTGGGTACTAAAAAATGG - Intergenic
1116933647 14:50715301-50715323 ACTCTGTTTGGCTTCTCAAAGGG - Intergenic
1118362728 14:65069749-65069771 ACTCTGTGGGGGCTCCCAGTTGG + Intronic
1120218825 14:81709938-81709960 ACTGTGTGGTCACTCTCAAAAGG - Intergenic
1121692062 14:95885055-95885077 GATCTGTGGGGTCTCTCAGATGG + Intergenic
1202857373 14_GL000225v1_random:59506-59528 ACTCTGTGGAGTCTCTCACCGGG - Intergenic
1124343780 15:28907714-28907736 AATCTGTGGGGACTCTCCCTGGG + Intronic
1126760467 15:51965347-51965369 GCTCTGTGGGGACACTTCAATGG + Intronic
1128282038 15:66403812-66403834 ACTCTGAGTCTACTCTCAAATGG - Intronic
1130133459 15:81162267-81162289 ACTCTGTGGGGTCTTTCCTAGGG + Intronic
1133091542 16:3408229-3408251 ACTCTGAGAGGTTTCTCAAAGGG - Intronic
1134402265 16:13920701-13920723 ACTGTGCGGGGACTCTGAGAGGG + Intronic
1134861450 16:17564090-17564112 ACTCTCTGGGGTCTCTCAGTGGG - Intergenic
1135036728 16:19084800-19084822 AATCTGTGGAGACGCTCACATGG + Intergenic
1136270794 16:29147055-29147077 GCTCTGTGGGGAGGCTCAACAGG + Intergenic
1139356706 16:66371197-66371219 ACTCTGTGGGGACTCTCAAATGG - Intronic
1140719556 16:77758969-77758991 ACCCTGTGGGGTCTCTTACAGGG + Intergenic
1142074372 16:88108835-88108857 GCTCTGTGGGGAGGCTCAACAGG + Intronic
1143307727 17:5960855-5960877 AATCTCTGGGGACTCTTGAAGGG + Intronic
1143374033 17:6457018-6457040 CCTGTGTGGGGACTCTGAGAGGG - Intronic
1144136840 17:12303103-12303125 GCTCTGTGGGGACACTAAAGTGG + Intergenic
1147543136 17:41378073-41378095 ACCCTGTGGCACCTCTCAAAAGG - Exonic
1147596476 17:41721282-41721304 TCTCTGAGGGGACCCGCAAATGG - Intronic
1153250471 18:3116740-3116762 ACTCTGAGGTGCCTCTCAAAGGG + Intronic
1156163781 18:34393366-34393388 ACTTTGAGGGCCCTCTCAAAGGG - Intergenic
1168368052 19:55806389-55806411 ACTCAGTGGCAACTCTCACATGG + Intronic
927682845 2:25151564-25151586 ACTCTGTGGGTATTTTGAAAAGG - Intronic
928184981 2:29102109-29102131 ACCCTGTGGGGTCTCTAAGAAGG + Intronic
930603980 2:53473347-53473369 TCTCTTAGGGGACTCTCACAAGG - Intergenic
931330175 2:61272601-61272623 AGTCTGTGGGCAAACTCAAAGGG - Intronic
935216661 2:100980367-100980389 ACTCTGTGAGGATTTTGAAAGGG - Intronic
936744306 2:115556023-115556045 AGACTCTGGGGACCCTCAAATGG - Intronic
937553320 2:123122473-123122495 AGACTCTGGGGACTCTTAAACGG + Intergenic
939298299 2:140298693-140298715 ACTCTGTGGGGACTAACATCAGG + Intronic
945061422 2:205912404-205912426 ACTCTGAGGGCACCCTTAAAAGG - Intergenic
948594090 2:239068317-239068339 GCTCTCTGGGGCCTCCCAAATGG + Intronic
1171152765 20:22842302-22842324 ATTCTACGGGGACTCCCAAATGG + Intergenic
1171367681 20:24637265-24637287 ACTCTGTGGTGTGTCTCATATGG + Intronic
1172586913 20:36092042-36092064 ACTCTCTGGGGACTCTCCAAGGG - Intronic
1173963088 20:47089933-47089955 TCTCGGTGGGGACTCTAATAAGG + Intronic
1174289316 20:49496477-49496499 CCTCTGTGGGGACCCTCTGATGG - Intergenic
1175851179 20:62093996-62094018 GCTCTCTGGAGACTCTCATAGGG - Intergenic
1175975271 20:62707758-62707780 ACCCTGTGAGGACACTCAGAGGG + Intergenic
1180061828 21:45389268-45389290 ACTCTGTGAAGACTTTAAAAAGG - Intergenic
1182572501 22:31249450-31249472 TCTCTGTGGGGCTTCTCAGAGGG + Intronic
1184988786 22:48153793-48153815 TCTCTTTGGGCACTTTCAAAAGG + Intergenic
951054436 3:18131559-18131581 ACTCTGAGGGAACTCTCAATTGG - Intronic
953715350 3:45312736-45312758 CCTCTCTGGGGACTCTGGAATGG - Intergenic
954961087 3:54565500-54565522 ACTCTCTTGTGTCTCTCAAAAGG + Intronic
955802534 3:62701023-62701045 GCTCTCTGGGGTCTCTCAGAAGG + Intronic
959553407 3:107689920-107689942 TCTCTGAGGCGCCTCTCAAATGG + Intronic
959689911 3:109187635-109187657 ACTCTGTGGGGAGTCACTGATGG - Intergenic
961009581 3:123426832-123426854 ACTCAGTGGGGGCTCCCAGAGGG + Intronic
964944101 3:162197496-162197518 ACTCCTTGGGGAATGTCAAAGGG - Intergenic
965522991 3:169687563-169687585 GCTCTGTGGGGACCCTCTCAAGG - Intergenic
969074034 4:4563128-4563150 AGACAGTGGGGACTCCCAAAGGG - Intergenic
970641469 4:18070878-18070900 ACACTGTGGCAACTCTCATAAGG + Intergenic
971390315 4:26179329-26179351 ACTCTTTGGGGAATCTGACATGG - Intronic
971584775 4:28391659-28391681 ACACTGTGGGGACTTTATAAAGG - Intronic
973004069 4:44987962-44987984 TCTCTGTGGGTATTCTAAAATGG + Intergenic
978302677 4:107289483-107289505 ACTCACTGGGGCCTCTCAGAGGG + Intergenic
981637883 4:146901064-146901086 ATTCTGTCTGGACTGTCAAATGG - Intronic
983005081 4:162474967-162474989 ACTTTGTGAGCACTCTCAGAAGG + Intergenic
985300532 4:188483899-188483921 GCACTGTGGGGACTGTAAAATGG - Intergenic
986575528 5:9208765-9208787 ACTCTTTGGTGTCTCTCCAATGG - Intronic
989788767 5:45365355-45365377 AGTCTTTGGGGACTCCAAAAGGG - Intronic
990330360 5:54719624-54719646 GCTCTGTGCTGACTCTCACACGG - Intergenic
990968026 5:61471039-61471061 ACCATGTGGGGACTCTGGAACGG - Intronic
992947790 5:81826376-81826398 ACTCTGTGGAGACTCTCTTTGGG + Intergenic
993718830 5:91301658-91301680 AATCTGTTTGGACTTTCAAAAGG - Intergenic
996755531 5:126931107-126931129 ACTCTGAGGAGATTCTGAAATGG + Intronic
997114412 5:131111109-131111131 ACTCCTTGGGAACTCTCATATGG - Intergenic
997303771 5:132824346-132824368 ACTCTGTGGGGACTGTAACCTGG + Exonic
997346760 5:133197849-133197871 AGGCTGTGGTGACTCTCACATGG - Exonic
999437958 5:151578913-151578935 ACTCTGTGTGAACTCTAAAAAGG + Intergenic
1000693463 5:164350850-164350872 AGTCTCTGGTGACTTTCAAAAGG + Intergenic
1001235716 5:170027681-170027703 ACTCTCTGGGCACTCCAAAAAGG + Intronic
1007174134 6:39884800-39884822 TATCTGTGGGGACTGCCAAAAGG + Intronic
1009981771 6:70734589-70734611 GCTCTGTGGGGACTCTGATGAGG + Intronic
1010017778 6:71124442-71124464 GCTCAGTGGGGTCTCTGAAAGGG + Intergenic
1010064702 6:71668663-71668685 TCTCTTTGGAGACTCACAAAGGG + Intergenic
1010326085 6:74563439-74563461 ACTCTTTGGGGACTATAAAGAGG - Intergenic
1014599691 6:123395426-123395448 AGCCTGTTGGGACACTCAAATGG - Intronic
1017048431 6:150368868-150368890 ACTCTGTGAGGACTTTGCAAAGG - Intergenic
1020140488 7:5608830-5608852 ACTCACTGGGGACTCTCAAGTGG - Intergenic
1022550537 7:31235199-31235221 TCTCTGGGGGTTCTCTCAAAAGG - Intergenic
1027774422 7:82445384-82445406 ACTCTGAGTGGCCTCACAAAAGG + Intergenic
1027945463 7:84739504-84739526 ACTCTTGGGGGGCTTTCAAAGGG - Intergenic
1028883999 7:95911370-95911392 CCTCTGTGGGGTCTCTCCACCGG - Intronic
1031515523 7:122693644-122693666 ACTCTATGGGGACTATAAAAGGG + Intronic
1032715480 7:134505645-134505667 GCTCTGTGGGGCCTCTCACAGGG - Intergenic
1033486538 7:141795152-141795174 ACTCTGTGGATACTGTCATAAGG - Intergenic
1034686315 7:152974340-152974362 CCTCAGCGGGGACTCTCAGATGG + Intergenic
1035680359 8:1483215-1483237 ACTTTGTGGGGAAACTCAGAAGG + Intergenic
1037790829 8:21940381-21940403 ACTCAGTGGGGACTATAAAATGG - Intronic
1040136559 8:43861200-43861222 ACTTTTTGGAGACTCTCCAAAGG + Intergenic
1040948024 8:52905299-52905321 AATCTGTGGGCATTCTAAAAGGG + Intergenic
1041558957 8:59192310-59192332 CCTTTAAGGGGACTCTCAAATGG - Intergenic
1042343367 8:67703480-67703502 TCTCTGTGGGTATTCTGAAATGG + Intronic
1042653622 8:71070322-71070344 ATGCTGTGGGGACTCTTAAGGGG + Intergenic
1043703085 8:83315104-83315126 ACGCTGTGGGGACAATCTAAAGG - Intergenic
1047795956 8:128256213-128256235 ACTTTTGGGGGACTCTCAAAAGG - Intergenic
1048344644 8:133567573-133567595 CATCTGTGGGGACTCCCAAATGG - Intronic
1048357705 8:133667152-133667174 ACTTTGTGGGGAGACTCCAAGGG + Intergenic
1048756953 8:137750075-137750097 ACTCTCTGGGGTTTCTCACAGGG + Intergenic
1051375991 9:16403498-16403520 CTGCTGTGGGGTCTCTCAAAGGG + Intergenic
1052209670 9:25888468-25888490 ACTCACTGGGGCCTCTCAGATGG + Intergenic
1053259132 9:36646547-36646569 GCACTGTTGGGAATCTCAAAAGG - Intronic
1061237372 9:129350923-129350945 GCGCTGTGGGGACTGTCAGAGGG + Intergenic
1186530621 X:10291540-10291562 GCTCTCTGGGGACTCTAACAGGG + Intergenic
1187822484 X:23302791-23302813 AATCTGTGGGGTATCTCTAAGGG + Intergenic
1189255627 X:39636734-39636756 ACTCTTTGCGGAAACTCAAATGG - Intergenic
1189807166 X:44747007-44747029 ACTCTGTGACTACTCTCGAATGG + Intergenic
1191989944 X:67024326-67024348 ACTCACTGGGGACTTTCAGAGGG - Intergenic
1193773032 X:85610131-85610153 ATTCTATCTGGACTCTCAAAGGG + Intergenic
1194101559 X:89711707-89711729 ACTCAGTGGGGTCTATCAGAGGG - Intergenic
1197431543 X:126372841-126372863 AGTCAATGGGGACTCTAAAAGGG + Intergenic
1197466631 X:126812689-126812711 ACTCTGTGGGCCCTTTGAAAGGG + Intergenic
1199478725 X:148274190-148274212 ACTGTGTGGGACCTCTCAACTGG + Intergenic
1200006573 X:153089210-153089232 ACTCTGTGGGAGCTATAAAAAGG - Intergenic
1200454507 Y:3372793-3372815 ACTCAGTGGGGTCTATCAGAGGG - Intergenic
1202621982 Y:56823405-56823427 ACTCTGTGGGGATCAACAAAGGG + Intergenic