ID: 1139359441

View in Genome Browser
Species Human (GRCh38)
Location 16:66388353-66388375
Sequence GATGCAGACGACCCCACTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139359437_1139359441 26 Left 1139359437 16:66388304-66388326 CCAGGATTCTCTCTCTGCAGGGA 0: 1
1: 0
2: 0
3: 18
4: 291
Right 1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1139359438_1139359441 3 Left 1139359438 16:66388327-66388349 CCTCAGTCATCTCTGTGACAGCA 0: 1
1: 0
2: 3
3: 40
4: 401
Right 1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1139359435_1139359441 27 Left 1139359435 16:66388303-66388325 CCCAGGATTCTCTCTCTGCAGGG 0: 1
1: 0
2: 1
3: 49
4: 378
Right 1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1139359433_1139359441 28 Left 1139359433 16:66388302-66388324 CCCCAGGATTCTCTCTCTGCAGG 0: 1
1: 0
2: 3
3: 60
4: 372
Right 1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139359441 Original CRISPR GATGCAGACGACCCCACTGT GGG Exonic
900866746 1:5274453-5274475 GATGCACCGGACCCCATTGTGGG + Intergenic
904746160 1:32712437-32712459 GACGCCGACCTCCCCACTGTCGG - Intergenic
905353136 1:37361193-37361215 GATGCAGATGATGACACTGTGGG - Intergenic
907253644 1:53161176-53161198 CATGTACACAACCCCACTGTGGG - Intergenic
911647412 1:100351885-100351907 GATGCAGACCCCCTCAGTGTTGG + Intronic
912512639 1:110199269-110199291 GAGGCAGAGGCCACCACTGTGGG - Exonic
912575958 1:110673530-110673552 GAGGCAGACGACCCCACTTCAGG - Exonic
1064548568 10:16475655-16475677 CATGGAGACTAACCCACTGTAGG + Intronic
1076547594 10:131255840-131255862 GGTGCAGACTTTCCCACTGTTGG - Intronic
1082124898 11:48420839-48420861 TAAGCAGATGAACCCACTGTTGG - Intergenic
1082558560 11:54592075-54592097 TAGGCAGATGAACCCACTGTTGG - Intergenic
1083742555 11:64718558-64718580 GAGGCAGCCTACTCCACTGTTGG - Intronic
1085272194 11:75277020-75277042 TATGCAGAAGTCCCCACTGGTGG - Intronic
1090599410 11:128354936-128354958 GAGGCAGAGATCCCCACTGTGGG - Intergenic
1090617968 11:128533381-128533403 GATGCAGAAGACCACCCTTTAGG + Intronic
1098561700 12:71880357-71880379 GCTGCAGACGACATCACTGGTGG - Intronic
1104081832 12:125435974-125435996 GAAGCAGAGGACCTCCCTGTGGG - Intronic
1123699198 15:22902191-22902213 GCTGCACTCGTCCCCACTGTGGG - Intronic
1129310126 15:74701605-74701627 GAAGCAGAAGACCACACTTTTGG + Intergenic
1137959636 16:52869347-52869369 GCTGCAGACAATCCCACTTTAGG - Intergenic
1139202529 16:64992983-64993005 GATGCAGATGACCCCACTTATGG - Exonic
1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG + Exonic
1140896115 16:79325854-79325876 GATACAGACGGCCCCAGTCTAGG + Intergenic
1141114389 16:81295923-81295945 AATGTAGACTACCCTACTGTTGG + Intergenic
1144707803 17:17380922-17380944 GAGGCAGAGCAGCCCACTGTGGG - Intergenic
1144716089 17:17436885-17436907 GCTGTAGAGGACCCCACTTTAGG + Intergenic
1153359561 18:4178124-4178146 GATTCAGACTATCCCACTATAGG + Intronic
1156911259 18:42413689-42413711 GATGCAGTCAACCCCACTGGAGG + Intergenic
1161015234 19:1979938-1979960 AATGCGGACGACCCCACGGCCGG + Exonic
1164593332 19:29518072-29518094 GATGCAGACACTGCCACTGTTGG - Intergenic
1168597306 19:57688378-57688400 TATGAAGAATACCCCACTGTGGG - Exonic
926165808 2:10521756-10521778 GATAAAGAAGGCCCCACTGTTGG + Intergenic
927242471 2:20930913-20930935 TATGCAGAAAACCCCACTGTTGG - Intergenic
929226389 2:39515548-39515570 GCTGCAGATGCCACCACTGTTGG - Intergenic
929934937 2:46287549-46287571 GATGCTGTGGAGCCCACTGTGGG - Intergenic
937136714 2:119559802-119559824 GACGCAGACAACCACACCGTGGG - Intronic
940285071 2:152026022-152026044 GATGCAGCCGACACCTCTGGAGG + Intronic
947980291 2:234403069-234403091 GATGCAGAGGCCCCCACAGCTGG - Intergenic
948936487 2:241168505-241168527 GTTGCAGAAGACGCGACTGTGGG - Intronic
948964757 2:241369777-241369799 GTTTCAGAAGAACCCACTGTTGG + Intronic
1179906295 21:44424918-44424940 GAGGCGGACGTCCCCACTCTGGG + Exonic
1182648363 22:31829113-31829135 GATCCAGACAACCGCTCTGTGGG - Intronic
1183074126 22:35415935-35415957 AATACAGACGACCCCACCATCGG - Exonic
1185035904 22:48476776-48476798 TATGCAGACCCCACCACTGTGGG + Intergenic
959662037 3:108879693-108879715 CATGCAGACAAACTCACTGTGGG + Intergenic
961346082 3:126264206-126264228 GAGGCAGAGGAGGCCACTGTGGG + Intergenic
968260944 3:197323722-197323744 GATGGAGACGTCCACACAGTGGG - Intergenic
984693400 4:182754599-182754621 AATGTACAGGACCCCACTGTAGG - Exonic
985383983 4:189425813-189425835 GAGTCAGATGACACCACTGTGGG + Intergenic
997383915 5:133457684-133457706 GATGCTGACGACTCCTTTGTAGG - Intronic
1000368052 5:160509277-160509299 GAGTCAGAGGACCCCAATGTTGG + Intergenic
1003171966 6:3727044-3727066 GATGCTGCCGACCCCAGTGCCGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007633413 6:43284989-43285011 GCTGCAGACGCCCCCAGGGTCGG + Exonic
1019158351 6:170053425-170053447 CAGGCAGCCGGCCCCACTGTTGG - Intergenic
1024199523 7:47091498-47091520 GAAGGAGAAGACCCCACTGAAGG - Intergenic
1047701460 8:127453173-127453195 GATGCACAAGTCCCCACTGCAGG - Intergenic
1057142743 9:92737475-92737497 GATCCTGACAACCCCAGTGTGGG + Intronic
1060557939 9:124518991-124519013 GAGACAGACAAACCCACTGTGGG - Exonic
1061750653 9:132774688-132774710 GATGGAGACGCCCCCATTTTTGG - Intronic
1062404507 9:136388745-136388767 GATGGAGAGCACCCCACGGTAGG + Intronic
1187021668 X:15388995-15389017 GATCCACATGACCCCAGTGTAGG + Intronic
1187246735 X:17559672-17559694 GATGGAGAAGACCCCTCTGCTGG + Intronic
1191054360 X:56227142-56227164 GATGGATACCACCCCTCTGTTGG + Intergenic
1192242980 X:69349471-69349493 GGTGCAGATGACCTCACTGGTGG - Intergenic
1201728989 Y:17185682-17185704 GATGCACAGGAGCCCACTGTGGG + Intergenic