ID: 1139361108

View in Genome Browser
Species Human (GRCh38)
Location 16:66400835-66400857
Sequence TGTCTGAGATGACCACGGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139361108_1139361113 -2 Left 1139361108 16:66400835-66400857 CCTACCCGTGGTCATCTCAGACA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1139361113 16:66400856-66400878 CAATGGGATGCCAAGTCGCACGG 0: 1
1: 0
2: 0
3: 8
4: 166
1139361108_1139361116 19 Left 1139361108 16:66400835-66400857 CCTACCCGTGGTCATCTCAGACA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1139361116 16:66400877-66400899 GGGCACCAGCACGCTGACCGTGG 0: 1
1: 0
2: 0
3: 9
4: 109
1139361108_1139361114 -1 Left 1139361108 16:66400835-66400857 CCTACCCGTGGTCATCTCAGACA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1139361114 16:66400857-66400879 AATGGGATGCCAAGTCGCACGGG 0: 1
1: 0
2: 1
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139361108 Original CRISPR TGTCTGAGATGACCACGGGT AGG (reversed) Exonic
902830899 1:19011912-19011934 AGTCTGAGGTGAGCAGGGGTGGG + Intergenic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
905732773 1:40307816-40307838 TGTCTCAGAGGAACAGGGGTGGG - Intronic
906451643 1:45954417-45954439 TGACTGAGATGACCATGGCGAGG + Intronic
906508918 1:46400234-46400256 AGTCTGAGAGGACCACAGCTTGG + Intronic
906854498 1:49290252-49290274 TGTCTGAGATCAGCTAGGGTTGG + Intronic
907248070 1:53120605-53120627 TGTCTAAGCTGACCCAGGGTTGG - Intronic
907921101 1:58912644-58912666 TGTCTGAGATGTGCAGAGGTGGG - Intergenic
911084142 1:93962605-93962627 TGGCTGAGAGAACCACAGGTAGG + Intergenic
912517762 1:110226730-110226752 TGCCAGAGATGACCAAGGGGTGG + Intronic
919627841 1:199929621-199929643 TGTCTGAGGAGAACATGGGTGGG - Intergenic
923721794 1:236473315-236473337 TGTCTTAGATCTCCACGGGCCGG - Intronic
1069854967 10:71435072-71435094 TGTCTGAGCTCAGCAAGGGTTGG + Intronic
1076220519 10:128729862-128729884 TTTCTAAGAAGCCCACGGGTTGG - Intergenic
1077371205 11:2182421-2182443 TGCCTAAGATGAGGACGGGTGGG - Intergenic
1077420337 11:2446993-2447015 TCTCTGAGATGTCCAAGGGTGGG + Intronic
1078865405 11:15292865-15292887 TGTTTGAGATGATCACTGGGTGG + Intergenic
1081814751 11:45932322-45932344 AATCTGAGAAGACCACGGGTAGG + Intronic
1082952849 11:58835898-58835920 TGTCTCATATGAACACTGGTGGG + Intronic
1083339470 11:61949856-61949878 TGTGTGTGGTGACCCCGGGTAGG - Intronic
1083859197 11:65411027-65411049 TGTCTGTGATGACCTTAGGTCGG + Intronic
1085902620 11:80719866-80719888 TGTCAAAGATGACTACTGGTCGG + Intergenic
1089559888 11:119338472-119338494 TTTCTGAGATGACCACAAGGGGG - Intergenic
1091794190 12:3287969-3287991 TGGCTGAGATGACCCGGGGGGGG + Intergenic
1093213173 12:16331674-16331696 AGTGTGAGATGACCTCAGGTAGG - Intergenic
1096752717 12:53772281-53772303 TGTCTGAGATGATCAGAGCTAGG - Intergenic
1106231415 13:27823941-27823963 TGTCTGAGATTCCCAGGGCTTGG - Intergenic
1110808812 13:79789644-79789666 AGTCTGAGATGACTAGGGGCTGG + Intergenic
1113437269 13:110303040-110303062 TGTCTTAGATCATCACTGGTGGG + Intronic
1118322504 14:64761535-64761557 TGTCTGAGATGGCAACTGGGGGG + Intronic
1119846576 14:77834911-77834933 GGTCTGAGATGGGCAAGGGTAGG - Intronic
1137645257 16:50067530-50067552 TGGCTGAGAAGAGCAGGGGTGGG + Intronic
1139025603 16:62814291-62814313 TGGCTGAGATGAGAAAGGGTGGG - Intergenic
1139361108 16:66400835-66400857 TGTCTGAGATGACCACGGGTAGG - Exonic
1139506174 16:67399167-67399189 CGGCTGAGATGGCCAAGGGTGGG - Intronic
1157575554 18:48740780-48740802 TTAATGAGTTGACCACGGGTAGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1163837617 19:19584601-19584623 GGTCTGACATGACCAAGGGCTGG + Intronic
929258395 2:39838789-39838811 TGTCTGTGATGAGGAGGGGTGGG + Intergenic
932397206 2:71456271-71456293 TTTCAGTGATGACCAGGGGTGGG - Intronic
934162694 2:89267481-89267503 TTTCTGAGAAGCCCATGGGTGGG - Intergenic
934204580 2:89915043-89915065 TTTCTGAGAAGCCCATGGGTGGG + Intergenic
936876426 2:117195135-117195157 TTTCACAGATGACCAAGGGTAGG + Intergenic
938601722 2:132849299-132849321 TGTCTGAGATAAGCAGGAGTTGG - Intronic
941977654 2:171423543-171423565 CATCTGAGATGACCTCAGGTGGG - Intronic
943575271 2:189624722-189624744 TCTCAGAGGTGACCACAGGTTGG + Intergenic
947708538 2:232295460-232295482 TCTCTGAGATGACAAGGGATTGG - Intronic
948180930 2:235979535-235979557 TGTCTGAGATGAGAAAGGGGTGG - Intronic
1168851883 20:982664-982686 GGTCTGATGTGACCTCGGGTAGG + Intronic
1171879727 20:30609844-30609866 TGTCTTAGGAGACCACAGGTGGG - Intergenic
1173957085 20:47041700-47041722 TGCCTGCCATGACCACGGGAGGG + Intronic
1174314606 20:49688472-49688494 TGTCTGAGCTGACCACAGCAAGG - Intronic
1183110360 22:35644328-35644350 TGTCTGACATGACTAGGGTTAGG - Intergenic
953885257 3:46711418-46711440 TGTATGAGAAGCCCATGGGTTGG - Intergenic
959102368 3:102025612-102025634 TGTCTGAGACGACACTGGGTGGG + Intergenic
962338352 3:134559151-134559173 TGTCTGTGCTGGCCATGGGTTGG - Exonic
967043917 3:185719025-185719047 GGTCAGAGATGACCTTGGGTGGG + Intronic
974184753 4:58431218-58431240 AGTCTGAGGTGACCGAGGGTGGG - Intergenic
980788572 4:137587815-137587837 TGGCTGAGCTGACCACTGGTTGG + Intergenic
982235710 4:153249392-153249414 TGTCTGAGATTTCCCCAGGTCGG + Intronic
1001298109 5:170513341-170513363 TATATGAGATGACCAGGGCTGGG - Intronic
1006583673 6:35091520-35091542 TGGCTGAGATGACGACAGCTTGG + Intergenic
1006999368 6:38294880-38294902 TGTCTGACATTACCAGGAGTTGG - Intronic
1011962460 6:93107858-93107880 TGACTGAGATGACCGAGGGAGGG - Intergenic
1017123085 6:151042135-151042157 GGTCTTAGATGACCACGAGCTGG - Intronic
1019776266 7:2913600-2913622 TGTCTGAGGTCACCTCGGGCTGG + Intronic
1026809721 7:73453180-73453202 TGGCTGAGTTGACCTCTGGTGGG + Intronic
1027486925 7:78773138-78773160 TTTCTGAGAAGACCACAGGCAGG + Intronic
1027487051 7:78774685-78774707 TTTCTGAGAAGACCACAGGCAGG + Intronic
1029219404 7:98976107-98976129 AGGCTGAGATGGCCACGGGCTGG - Intronic
1045856343 8:106769669-106769691 TGTCTGAGCTAACCAAGGGCTGG - Exonic
1056094946 9:83243164-83243186 TGGCTGAGCTCACCACGGGCAGG + Intronic
1058587613 9:106527509-106527531 TGTCTGAGGTGAGCACAGGTTGG - Intergenic
1058667530 9:107334242-107334264 GGCCTGAGATGGCCAAGGGTGGG + Intergenic
1061638866 9:131935687-131935709 GGGTGGAGATGACCACGGGTCGG + Intronic
1187763806 X:22617113-22617135 TGTCTGAGGTCACCAAGGGATGG + Intergenic
1188695112 X:33180566-33180588 TGTCAGAGAGGAGCAGGGGTGGG - Intronic
1189576651 X:42360956-42360978 TGTCTGGCATGGCCACGGCTAGG - Intergenic