ID: 1139361362

View in Genome Browser
Species Human (GRCh38)
Location 16:66402171-66402193
Sequence CTATATACATAAGTAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139361362_1139361364 7 Left 1139361362 16:66402171-66402193 CCCAGCTTTACTTATGTATATAG 0: 1
1: 0
2: 0
3: 15
4: 242
Right 1139361364 16:66402201-66402223 TTCAGTAACTCAAAGCTAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139361362 Original CRISPR CTATATACATAAGTAAAGCT GGG (reversed) Intronic
902810874 1:18887103-18887125 CTATTTAGATTAGTAAATCTGGG - Intronic
903933135 1:26875680-26875702 CTATTTACAAAAGTAAAAGTTGG + Intergenic
907207230 1:52783781-52783803 ATATATATATATATAAAGCTGGG - Intronic
908036363 1:60058562-60058584 GTATATAAATAAGTATAGCGTGG - Intronic
908674552 1:66589206-66589228 ATATATATATATGTAAGGCTTGG + Intronic
908854495 1:68409412-68409434 ATATATACATAATTGAAGCATGG - Intergenic
909622063 1:77680008-77680030 GTATCTACATAAGTTTAGCTTGG - Intronic
910938350 1:92505600-92505622 CTATGGAGAAAAGTAAAGCTAGG + Intergenic
911580901 1:99632115-99632137 CTATGTACACAACTAAAGCCTGG + Intergenic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
917361025 1:174176412-174176434 CAATATAAAGAAGTCAAGCTGGG + Intronic
918608132 1:186454646-186454668 TTATACATAAAAGTAAAGCTAGG + Intronic
920569455 1:207005593-207005615 CTATCTAGATAAGTAACCCTGGG - Intergenic
921735754 1:218626209-218626231 CAATATATATATATAAAGCTAGG + Intergenic
923348827 1:233083544-233083566 ATATAGACATAAGTATAGCACGG - Intronic
923693461 1:236221611-236221633 CTATATACATATGTAAAATACGG + Intronic
923987421 1:239397093-239397115 CTAAAGACATAAGTATAGCTTGG - Intronic
1063413418 10:5854128-5854150 ATAAATACATAAATAAAGTTAGG + Intergenic
1063618149 10:7620227-7620249 CTATAAACACAAGTCAAACTTGG + Intronic
1065482623 10:26211018-26211040 CTACACAGAAAAGTAAAGCTGGG - Intronic
1065988999 10:30989126-30989148 CTATATACTTAAGTAAGAGTTGG - Intronic
1066262216 10:33739945-33739967 CTACAAACATCAGTATAGCTGGG + Intergenic
1066417813 10:35237544-35237566 CTATTTGCATAAGTACATCTCGG - Intergenic
1068220121 10:54033358-54033380 CTTTATACATAAGAAAAGTAAGG + Intronic
1068982231 10:63073714-63073736 CTAAATAAATAAATAAATCTTGG - Intergenic
1071823914 10:89305553-89305575 CAAAGTACAAAAGTAAAGCTAGG + Intronic
1072945968 10:99810403-99810425 CTAGATTGCTAAGTAAAGCTGGG + Intronic
1074054164 10:109907080-109907102 CCTTATACATAAGTAAAGGCTGG + Intronic
1075600883 10:123768407-123768429 ATAAATAAATAAATAAAGCTCGG + Intronic
1077782760 11:5349491-5349513 AAATATACCTAAATAAAGCTGGG - Intronic
1078767823 11:14316580-14316602 CTAAATAAATAAATAAAGCCAGG + Intronic
1082115874 11:48327727-48327749 CTATATACCTCAATAAAGCTGGG + Intronic
1082257816 11:50051771-50051793 CTATATACCTCAATAAAGCTGGG - Intergenic
1082686840 11:56248492-56248514 CTATGTACATAAGTAAGTCTTGG - Intergenic
1083018303 11:59479361-59479383 GCATATACATATATAAAGCTTGG + Intergenic
1083373846 11:62203903-62203925 CAATTTACCTTAGTAAAGCTGGG + Intergenic
1083565269 11:63709857-63709879 CTATATACATCAGTGAAGAATGG - Intronic
1086213692 11:84351449-84351471 TTATATAAATAAATAATGCTCGG + Intronic
1086330066 11:85745121-85745143 CTATATTCTTAACTATAGCTAGG - Intronic
1087884986 11:103469862-103469884 TTATATACAAAAGTTAAGGTTGG + Intronic
1089450699 11:118594088-118594110 ATTTATAAATAAGTAAAGCAAGG + Intronic
1089783766 11:120893533-120893555 CTGTATTCATAAGGAAAGCAGGG - Intronic
1090108797 11:123882450-123882472 CTATCTATGTAAGTAAAACTTGG - Intergenic
1092502152 12:9058965-9058987 GTCTATACATAAACAAAGCTGGG + Intergenic
1092998874 12:13977227-13977249 ATATATACATTAGCAAAGCATGG + Intronic
1093606993 12:21104129-21104151 ATATATACACATGTAAAGTTTGG + Intronic
1093660937 12:21755841-21755863 CCATATACATAGGAAATGCTTGG - Intronic
1094523095 12:31213905-31213927 CTAAATACATAAGTAAAATGGGG + Intergenic
1097671828 12:62549322-62549344 TTAAATGCATAAGTAAGGCTGGG + Intronic
1098514878 12:71363416-71363438 ATATATACAAAAGCACAGCTAGG + Intronic
1099675270 12:85753125-85753147 ATATAAAAATAAGAAAAGCTAGG - Intergenic
1099843717 12:88001444-88001466 CTATATTCATAGGAAAAGTTTGG + Intronic
1102003758 12:109575357-109575379 CTATATACCTTGGTAGAGCTTGG + Intronic
1102968089 12:117144095-117144117 CTAGATACATATGTACAGCTGGG + Intronic
1103260118 12:119579815-119579837 GAATAGACATAAGTAAACCTAGG - Intergenic
1103791308 12:123473531-123473553 ATATATATATAAGTAAAACATGG + Intronic
1104250817 12:127091924-127091946 ATATATATATATGAAAAGCTTGG + Intergenic
1107276413 13:38685582-38685604 CTCTGTACATAAGTATGGCTGGG - Intergenic
1108391713 13:49953614-49953636 GTAAATAAATAAATAAAGCTGGG - Intergenic
1109798740 13:67347412-67347434 TTACATACAGAATTAAAGCTTGG + Intergenic
1111288564 13:86129994-86130016 CTATATATAAAAGAAAAGATGGG - Intergenic
1111724380 13:91986497-91986519 CTATATGAAAATGTAAAGCTGGG - Intronic
1112195595 13:97223170-97223192 TTATATTCAAAAGTAAAGCTGGG + Intronic
1112819422 13:103314047-103314069 CTATATACTTAGGAAAAGGTGGG + Intergenic
1114475669 14:22992876-22992898 CTTAATAAATAAATAAAGCTGGG - Intronic
1114866392 14:26598942-26598964 GGATATAAATAAATAAAGCTAGG + Intergenic
1115212924 14:30985721-30985743 CTATAAACATAAGTCAAACATGG - Intronic
1116059855 14:39909008-39909030 TCATATACATAAGAGAAGCTGGG - Intergenic
1116843920 14:49847182-49847204 ATAAATAAATAAGTAAAGGTTGG - Intronic
1117494300 14:56286449-56286471 TTATATATATAAGAAAAGTTTGG - Intronic
1118718579 14:68577676-68577698 CTATATAGAAAAATAAAGCAGGG - Intronic
1121295474 14:92817517-92817539 CTATATTTAAAAGTAAAGTTGGG + Intronic
1122110514 14:99497681-99497703 GTATATACATACATAATGCTTGG - Intronic
1125208899 15:37187784-37187806 GTATATACAGATGTAAAGATGGG + Intergenic
1125568822 15:40698568-40698590 ATATAAAAATAAGTAAAACTTGG + Intronic
1127015703 15:54684783-54684805 CTATATAAATAAATAAGACTAGG + Intergenic
1127548802 15:60016655-60016677 CTATATACATCTTTAAAGATGGG - Intronic
1129528371 15:76239245-76239267 AAATATACCTCAGTAAAGCTGGG - Intronic
1131372204 15:91892002-91892024 CTAGATAAATAAGTAATCCTGGG + Intronic
1131396266 15:92088987-92089009 ATAAATAAATAAATAAAGCTGGG - Intronic
1131931504 15:97448092-97448114 CTAAACACATAAATAAAGTTAGG + Intergenic
1133134872 16:3703718-3703740 CTATTTACAAAAGTTAGGCTGGG + Intronic
1133543447 16:6779684-6779706 ATATATAAATAAATAAAGATAGG - Intronic
1133549788 16:6843084-6843106 CTATTTACAATAGTAAATCTTGG - Intronic
1134618620 16:15670839-15670861 TCCTATACATTAGTAAAGCTGGG - Intronic
1134649339 16:15896268-15896290 CTATGGACAAAAGTAAGGCTGGG - Intergenic
1138437164 16:57009296-57009318 ATAAATAAATAAATAAAGCTGGG + Intronic
1138717371 16:59039186-59039208 CTATTTACACAAGAAGAGCTAGG + Intergenic
1139361362 16:66402171-66402193 CTATATACATAAGTAAAGCTGGG - Intronic
1143465767 17:7135231-7135253 TTATAAAAATAAATAAAGCTGGG + Intergenic
1143630130 17:8134213-8134235 CTATAGAAATAAATTAAGCTTGG + Intergenic
1147596309 17:41720182-41720204 ATAAATAAATAAATAAAGCTGGG - Intronic
1150810278 17:68350814-68350836 ATAAATACATAAATAAAGCTTGG + Intronic
1151249745 17:72825020-72825042 AAATATACATAAGTAAAGAGGGG + Intronic
1151877948 17:76877958-76877980 CCATATAAATAAGGAAAGCTGGG - Intronic
1153111535 18:1596037-1596059 CTACATGTATCAGTAAAGCTTGG + Intergenic
1153471858 18:5455312-5455334 CTCTTTACATAGGTAAAACTGGG + Intronic
1153836216 18:8966397-8966419 CTAGAGACATGAGCAAAGCTGGG - Intergenic
1155974359 18:32112357-32112379 ATAAATACATAAGTAAAGTGAGG - Intronic
1156147532 18:34203441-34203463 ACATACACACAAGTAAAGCTGGG + Intronic
1156917643 18:42480450-42480472 CTTTAAACATAACAAAAGCTGGG - Intergenic
1158983738 18:62792185-62792207 CCAAGTCCATAAGTAAAGCTCGG - Intronic
1160342279 18:78099946-78099968 ATATATACATCAGTAAATCTTGG - Intergenic
1161418923 19:4164706-4164728 CTAAATAAATAAATAAAGGTGGG - Intronic
1162814057 19:13182501-13182523 ATATATATATATGTAAAGATGGG - Intergenic
1164559756 19:29282424-29282446 ATAAATAAATAAATAAAGCTAGG + Intergenic
1165086308 19:33350372-33350394 CTAAATACATAAATAAAAATAGG + Intergenic
1166692890 19:44834500-44834522 CTAAATAAATAAATAAGGCTGGG - Intergenic
928567980 2:32573034-32573056 CTATATAGAAAACTAAAGCAGGG - Intronic
930058347 2:47269201-47269223 ATAAATAAATAAGTAAAGTTTGG + Intergenic
930931036 2:56883269-56883291 CAATTCACATAAGGAAAGCTTGG + Intergenic
931461587 2:62454680-62454702 ATACATAAATAAATAAAGCTGGG - Intergenic
932552875 2:72789742-72789764 GTATATAGATAAGTAAATATAGG + Intronic
932858950 2:75268189-75268211 CTATTTACATAAGCCAAGCATGG - Intergenic
935734737 2:106097519-106097541 CTATATACAGAAGCACAGCAGGG + Intronic
937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG + Intronic
939664274 2:144931250-144931272 GTATATACTTCAATAAAGCTGGG - Intergenic
942368991 2:175260921-175260943 CTATATGCATAAGGAAACTTTGG - Intergenic
942383667 2:175419623-175419645 ATCTAGACATAGGTAAAGCTGGG - Intergenic
943903616 2:193471782-193471804 CTCTATACATGAGTGAAGCTGGG - Intergenic
944184323 2:196930193-196930215 TTAGATATAAAAGTAAAGCTAGG - Intergenic
944769562 2:202899872-202899894 CTATTAACATTAGGAAAGCTGGG + Intronic
946532311 2:220584233-220584255 ATATATACATATGTAAAGTGGGG + Intergenic
946613873 2:221488335-221488357 CTATATACATAGGTTAATCAGGG - Intronic
949055141 2:241923687-241923709 CTATGTGCAGAGGTAAAGCTGGG + Intergenic
1169002243 20:2176598-2176620 CTTTTTACATAATTAAAGATGGG - Intronic
1170320602 20:15093494-15093516 CTCTACTCATAGGTAAAGCTTGG + Intronic
1170409871 20:16077190-16077212 TTATTTACATAAGTACAACTAGG + Intergenic
1170945404 20:20887011-20887033 ATATATATGTATGTAAAGCTGGG - Intergenic
1172194972 20:33085459-33085481 ATAAATACATAAATAAATCTGGG + Intronic
1173566532 20:44042806-44042828 CTATATAAATAAGTCAGGCCAGG - Intronic
1174745862 20:53061959-53061981 CTATGTAAATAAGTAAGTCTGGG + Intronic
1178018479 21:28379794-28379816 CTATGTACATAAATAAGACTAGG - Intergenic
1179272313 21:39861018-39861040 CTATAGACAGAAATAAAGCAAGG - Intergenic
1182931098 22:34175027-34175049 CTATAAAGATAATTTAAGCTTGG + Intergenic
1183014877 22:34977844-34977866 GTAAGTACATAAGCAAAGCTAGG - Intergenic
1183203224 22:36400605-36400627 ATAAATAAATAAGTAAAGCCAGG + Intergenic
949123021 3:410780-410802 ATATATACATGAGTAAAGAAAGG + Intergenic
949338014 3:2997987-2998009 TTATAAATGTAAGTAAAGCTTGG + Intronic
955115819 3:56000361-56000383 CTATATACATAAAAAAATTTAGG + Intronic
956492012 3:69782793-69782815 CTATCTACTTCAGTAAATCTAGG + Intronic
956516722 3:70057619-70057641 GTATATGCATATGTATAGCTTGG - Intergenic
956692314 3:71889674-71889696 CTATATAGATACATAAAGCCTGG + Intergenic
957025377 3:75175862-75175884 TTATATACATATGTAAGGTTTGG - Intergenic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
959144549 3:102529152-102529174 CTATAAATATAAGGAAAGCTGGG - Intergenic
960222905 3:115136422-115136444 CTATAAAGATAAATAAAGCATGG + Intronic
960284910 3:115817257-115817279 CTATTTAGATTAGTAAAGCAGGG - Intronic
960630281 3:119723530-119723552 CTGTATATATCAGTACAGCTAGG + Intronic
961850120 3:129808185-129808207 ATATATATATAAATAAGGCTGGG + Intronic
962977796 3:140461200-140461222 CTATATAAATAGGGAAAGCCAGG - Intronic
963441910 3:145350894-145350916 CTATATACTTTATTATAGCTGGG + Intergenic
964172094 3:153782976-153782998 TTTTAAACATAATTAAAGCTCGG - Intergenic
964408499 3:156374761-156374783 CTTCATACATAAGGAAAGCGAGG - Intronic
965842640 3:172924931-172924953 CTAATTACATAAGAAAAGCGGGG + Intronic
966557087 3:181274815-181274837 CTATATACCTTATTAAAACTTGG - Intergenic
967683432 3:192392433-192392455 ATAAATAAATAAATAAAGCTGGG + Intronic
967813722 3:193781688-193781710 ATAAATAAATAAGTAACGCTAGG - Intergenic
971020776 4:22533300-22533322 CAATATACATAAGTATTGCCAGG + Intergenic
972400685 4:38699805-38699827 ATATATATATAAGAAAAGTTTGG - Exonic
972695828 4:41445410-41445432 CTTTCTGCCTAAGTAAAGCTTGG - Intronic
975132424 4:70842432-70842454 CTATATAAATAAGTAACTCTAGG - Intergenic
975294313 4:72714721-72714743 CTGTATAGATAAGTAAACCAAGG - Intergenic
977304405 4:95304612-95304634 ATGTATAAATAAGTAAAGCAGGG - Intronic
977400598 4:96526393-96526415 CGAAATACATAAGAAAAACTAGG - Intergenic
977569793 4:98617299-98617321 TTTTATACATAAAGAAAGCTAGG + Intronic
978109370 4:104944193-104944215 CTATATACATCAGAAAAGATAGG - Intergenic
978172848 4:105694624-105694646 AGATCTACATAAGTGAAGCTGGG - Intronic
979651182 4:123133528-123133550 AAATATATATAAATAAAGCTAGG - Intronic
979870540 4:125814775-125814797 GTATATACATAATTAGATCTTGG - Intergenic
980505633 4:133716622-133716644 CTAAATAGAAAAGTCAAGCTGGG - Intergenic
980604280 4:135068882-135068904 ATATATACATATGTAAACATAGG + Intergenic
980725403 4:136752755-136752777 CTATTTTCAGAAGTAAAACTAGG + Intergenic
981114402 4:140973192-140973214 AATTATACATCAGTAAAGCTAGG + Intronic
982526048 4:156480163-156480185 TTATACACATAAGTAAAGTGAGG + Intergenic
982749815 4:159146768-159146790 CTAGATACCAAAGAAAAGCTGGG - Intronic
983769146 4:171526561-171526583 AAATATACATAAGTTCAGCTGGG + Intergenic
984606707 4:181794131-181794153 AAATATACTTCAGTAAAGCTGGG - Intergenic
985239847 4:187918576-187918598 CTATGAAGAAAAGTAAAGCTGGG + Intergenic
986177166 5:5362534-5362556 CTACATGCAAAAGTCAAGCTGGG + Intergenic
987577327 5:19746850-19746872 ATATATATATAAGTAAAAATTGG + Intronic
987622548 5:20354411-20354433 CTAAATAAATAAATAAAGCAAGG - Intronic
988024863 5:25672193-25672215 TTATATGCTGAAGTAAAGCTTGG + Intergenic
988726854 5:33935131-33935153 TTATCTCCTTAAGTAAAGCTGGG + Intergenic
990668974 5:58105691-58105713 ATATATACATAAGAATAGATGGG - Intergenic
991594183 5:68285764-68285786 GTTTATACATACGTAAACCTGGG + Intronic
994106079 5:95950865-95950887 ATATATATATAAATAAAACTTGG - Intronic
995562836 5:113401754-113401776 ATATATAAATAAGAAAACCTGGG - Intronic
995581176 5:113604644-113604666 CAATATACAGAAATACAGCTGGG - Intergenic
995889211 5:116931870-116931892 CCACATGAATAAGTAAAGCTAGG + Intergenic
996886790 5:128365733-128365755 ATTTATACATAAATAAAACTTGG - Intronic
997152004 5:131507137-131507159 TTATATATATAAGTAAAAATTGG - Intronic
1000843394 5:166249831-166249853 CTATATTTAGAAGTAAACCTAGG - Intergenic
1000949886 5:167467760-167467782 CCATATACATAAATCAAGCAGGG - Intronic
1002886861 6:1304952-1304974 GAATATACATAAGAACAGCTTGG - Intergenic
1005647104 6:27850686-27850708 CTATACACATAATAAAAACTGGG + Intronic
1007534635 6:42575052-42575074 CTACATACATAAATACAGATGGG + Intronic
1008479314 6:51968563-51968585 CTATATTCAGTATTAAAGCTGGG - Intronic
1010228590 6:73514614-73514636 CTAAATACAAAAGAAAAGCAAGG - Intergenic
1011280803 6:85675544-85675566 CTCTATAAATAAGTAAAACTGGG - Intergenic
1011341570 6:86321014-86321036 ATATATACATATATATAGCTTGG - Intergenic
1012346128 6:98189098-98189120 CTATAAACATATTTAAAGCATGG - Intergenic
1012676533 6:102120006-102120028 CTATATACATGAGTAGATTTGGG - Intergenic
1013728872 6:113137977-113137999 CTATATACTTAAGTAACTTTAGG - Intergenic
1015971617 6:138748307-138748329 CTATAAAGATATGTAAGGCTTGG + Intergenic
1017483231 6:154879129-154879151 CTATATACACAAGTATGGCGTGG + Intronic
1018522014 6:164659777-164659799 CTGTGGACATAACTAAAGCTAGG + Intergenic
1018575972 6:165260315-165260337 TTATATACTTTAATAAAGCTGGG - Intergenic
1019679719 7:2340034-2340056 ATATCTACATATGAAAAGCTAGG + Intronic
1020594828 7:10193072-10193094 CTATATACTTATGTAAAAGTTGG - Intergenic
1022067962 7:26880370-26880392 CTATATTCATTAGTCAAGCCCGG - Intronic
1024809873 7:53196478-53196500 CTACAAACACAAGAAAAGCTTGG + Intergenic
1026990417 7:74582016-74582038 ATAAATAAATAAATAAAGCTTGG + Intronic
1028568272 7:92257381-92257403 CTATATTTATAAGTAGAGCAGGG + Intronic
1031703553 7:124955941-124955963 GATTATACATCAGTAAAGCTGGG + Intergenic
1034206735 7:149322992-149323014 ATATATACTTAAATAAAGATAGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034637918 7:152581939-152581961 ATATATATATATATAAAGCTGGG + Intergenic
1034982156 7:155486115-155486137 AGATACACATATGTAAAGCTTGG + Intronic
1035079286 7:156202900-156202922 CTTTGTACATAAGAAAAGTTAGG + Intergenic
1037151825 8:15645213-15645235 CTATTTACACAATAAAAGCTGGG + Intronic
1038066269 8:23966867-23966889 CTATATTCATAAGAACAACTGGG - Intergenic
1039271570 8:35886902-35886924 CTGTAAACCTAAGTAAAGATTGG - Intergenic
1040984815 8:53281835-53281857 CTAGATACATAAATAAATTTAGG + Intergenic
1044050531 8:87497291-87497313 CTATAGAAATAATTAAAGCAAGG + Intronic
1044288793 8:90442900-90442922 GTACATACATAAATAAAACTGGG + Intergenic
1044673726 8:94709398-94709420 ATAAATAAATAAATAAAGCTGGG - Intergenic
1046644795 8:116774526-116774548 CTATATACATATATATATCTTGG - Exonic
1046666760 8:117012191-117012213 GTATATACAAAATTAAAGATAGG + Intronic
1049846869 8:144807063-144807085 ATTTATACCTCAGTAAAGCTGGG + Intronic
1051318508 9:15871353-15871375 TTATAAACATAATTAAAGATTGG + Intronic
1052111478 9:24589311-24589333 CTATATACAGAAGTAATGTTTGG + Intergenic
1055108215 9:72534347-72534369 CCATCTACATAATTAAAGGTTGG - Intronic
1055378142 9:75673389-75673411 ATAAATAAATAAATAAAGCTGGG - Intergenic
1057811829 9:98263368-98263390 CTATACACATAAATAAATATGGG + Intergenic
1057934458 9:99225275-99225297 CTATGAAGATAAATAAAGCTGGG + Intronic
1058125122 9:101183729-101183751 CCATATACATATAAAAAGCTTGG + Intronic
1058741676 9:107949041-107949063 ATATATATATAAGTAAACCAAGG - Intergenic
1059059583 9:111021300-111021322 CATTATACATCAATAAAGCTAGG + Intronic
1060390660 9:123273775-123273797 ATATATACATAGGAAAAGTTTGG - Intergenic
1061654741 9:132080195-132080217 CCATATTCATAAATAAAGCGGGG + Intergenic
1185567269 X:1104813-1104835 GAATATAAATAAGTAAAGTTAGG + Intergenic
1187329519 X:18324094-18324116 CTATATATATAAATAAAATTTGG + Intronic
1188307579 X:28577084-28577106 ATAAATACATAAATAAAACTAGG + Intergenic
1188315743 X:28671207-28671229 CTAGATACAAAAGTACAACTAGG - Intronic
1188535222 X:31189532-31189554 CTATATAGAGAAGTAAACATTGG + Intronic
1188721814 X:33531333-33531355 CTAAATACATATGAAAGGCTGGG - Intergenic
1191923805 X:66287076-66287098 CTATTTTGAAAAGTAAAGCTTGG + Intergenic
1194669440 X:96712386-96712408 ATATGTACATAATTAAAGTTAGG + Intronic
1194703066 X:97138286-97138308 CTATATACCTAACTAAATTTTGG + Intronic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1194937785 X:99971518-99971540 CTATAGAGAAAAATAAAGCTTGG - Intergenic
1197453157 X:126642809-126642831 TGATATACATAAGGAAAGATAGG - Intergenic
1197515679 X:127425401-127425423 CTTTATACATACGTAGAGATTGG + Intergenic
1198122959 X:133612178-133612200 CTAGAAACAGAAGTCAAGCTGGG - Intronic
1198153554 X:133934493-133934515 ATATATATATAAATAAAGTTTGG - Intronic
1198240943 X:134785341-134785363 ATTTATACTTCAGTAAAGCTGGG - Intronic
1199022870 X:142902908-142902930 TTATATACAAAAATTAAGCTAGG - Intergenic