ID: 1139364321

View in Genome Browser
Species Human (GRCh38)
Location 16:66424468-66424490
Sequence TGGGATTCCCTGTGAGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139364317_1139364321 8 Left 1139364317 16:66424437-66424459 CCTGTTCTTTGCAAACAGAAAAG No data
Right 1139364321 16:66424468-66424490 TGGGATTCCCTGTGAGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139364321 Original CRISPR TGGGATTCCCTGTGAGCGGC TGG Intergenic
No off target data available for this crispr