ID: 1139364826

View in Genome Browser
Species Human (GRCh38)
Location 16:66427039-66427061
Sequence CGGGAGCCGCGCCGCCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139364820_1139364826 1 Left 1139364820 16:66427015-66427037 CCGCGGCGCCGCGGTGCTGAGGC No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364814_1139364826 23 Left 1139364814 16:66426993-66427015 CCGCATCTCGGAGTGACCCGGGC No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364818_1139364826 6 Left 1139364818 16:66427010-66427032 CCGGGCCGCGGCGCCGCGGTGCT No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364809_1139364826 28 Left 1139364809 16:66426988-66427010 CCGCCCCGCATCTCGGAGTGACC No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364817_1139364826 7 Left 1139364817 16:66427009-66427031 CCCGGGCCGCGGCGCCGCGGTGC No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364807_1139364826 30 Left 1139364807 16:66426986-66427008 CCCCGCCCCGCATCTCGGAGTGA No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364812_1139364826 24 Left 1139364812 16:66426992-66427014 CCCGCATCTCGGAGTGACCCGGG No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364823_1139364826 -7 Left 1139364823 16:66427023-66427045 CCGCGGTGCTGAGGCCCGGGAGC No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364808_1139364826 29 Left 1139364808 16:66426987-66427009 CCCGCCCCGCATCTCGGAGTGAC No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data
1139364810_1139364826 25 Left 1139364810 16:66426991-66427013 CCCCGCATCTCGGAGTGACCCGG No data
Right 1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139364826 Original CRISPR CGGGAGCCGCGCCGCCGCCG AGG Intergenic
No off target data available for this crispr