ID: 1139370085

View in Genome Browser
Species Human (GRCh38)
Location 16:66461664-66461686
Sequence TGCCATGGCCAGGGGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139370075_1139370085 13 Left 1139370075 16:66461628-66461650 CCAACTCTAGGTTTGCAATCTAA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG 0: 1
1: 0
2: 1
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139370085 Original CRISPR TGCCATGGCCAGGGGTCATG GGG Intronic
900457763 1:2785759-2785781 TGCCAGGCACAGGGGACATGGGG - Intronic
900525268 1:3125427-3125449 TGTCATCGCCAGGGCACATGGGG + Intronic
901030110 1:6302200-6302222 TGCCCTGGCCAGTGTCCATGAGG - Intronic
902698887 1:18158192-18158214 TGCCATGGCAGGGGGTCCTAAGG - Intronic
904540500 1:31229727-31229749 TGTCAGGGCCTGGGGTCAGGAGG - Intronic
904829809 1:33299488-33299510 TGCCATGGCCTCAGGTCTTGAGG + Exonic
909927724 1:81458509-81458531 GGCCCTGGGCAGAGGTCATGTGG - Intronic
912214976 1:107599123-107599145 TTCCAAGGCCTAGGGTCATGCGG + Intronic
915087840 1:153400127-153400149 TGCCCTGGCCATGGGTAGTGGGG - Intergenic
915844297 1:159247457-159247479 TGGAATGGGCAGGGGTGATGGGG + Intergenic
917987196 1:180332772-180332794 TACCATGGACTGGGGTCAGGGGG - Intronic
918310351 1:183281249-183281271 TGCAATTGCCAGGGGACATTGGG + Intronic
920306262 1:205020108-205020130 TGCCAGGGGCAGGGGCAATGGGG - Exonic
921005117 1:211085563-211085585 GGCCTGGGCCAGGGGTCAAGGGG + Intronic
921211180 1:212900053-212900075 TGGGGTGGCCATGGGTCATGTGG - Intergenic
921538247 1:216379194-216379216 CTCCATGGGCAGGGGACATGTGG - Intronic
922738355 1:228001893-228001915 TGCCCTGGGCAGGGGCCACGGGG + Intergenic
922791670 1:228314448-228314470 AGCCAGGGCCAGAGGGCATGGGG + Intronic
922801220 1:228365597-228365619 AGCCCTGGGCAGGGGGCATGGGG - Intronic
923012470 1:230099354-230099376 TGCCATGGTCAGATGTCTTGGGG + Intronic
923051092 1:230392125-230392147 TGCCTTGGTCATGTGTCATGGGG + Intronic
1063368755 10:5507584-5507606 TGCAATGGCCAGGGGGACTGAGG + Intergenic
1065428460 10:25630180-25630202 TCCCACGGCCAGGGGTTCTGAGG + Intergenic
1065760382 10:28976286-28976308 TGCCATAGCCGGGGGTCAGCAGG - Intergenic
1065954816 10:30684202-30684224 CGCCATAGACAGGGGTCTTGTGG + Intergenic
1067559874 10:47297721-47297743 TGCAATTGCCAGGGGTGCTGAGG - Intergenic
1068147582 10:53090880-53090902 TGCCATGCCCACTGGTAATGGGG - Intergenic
1068487332 10:57677068-57677090 TGCCATTGCCTTGTGTCATGTGG - Intergenic
1070645524 10:78199553-78199575 TGGCATGGTCACGGGCCATGGGG + Intergenic
1070670699 10:78375371-78375393 TGCCAGGCCCTGGGGTGATGGGG + Intergenic
1070932490 10:80271196-80271218 TGCCATGGCCCCCGGTGATGTGG - Intergenic
1072276529 10:93828723-93828745 TGGCATTGCCAGGTGGCATGGGG - Intergenic
1072721165 10:97781825-97781847 TGCCAGCCCCAGGGGTCCTGAGG - Intergenic
1072782774 10:98261614-98261636 GGCCATGGCCAGCTGTCCTGAGG + Intronic
1073450293 10:103605205-103605227 ATCAAAGGCCAGGGGTCATGTGG + Intronic
1074719284 10:116250762-116250784 AGCTATGGCCAGGGGTCCTGAGG - Intronic
1076130369 10:128009875-128009897 CTCCATGGCCAGGAGTCAGGGGG + Intronic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1077600685 11:3572472-3572494 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1078152667 11:8772704-8772726 TGCCATGACCAGGGGACACCTGG + Intronic
1078385011 11:10882438-10882460 TGCCATGGCTAGGGGTAAAAAGG - Intergenic
1082057857 11:47834742-47834764 TGATATGGCCAGGTGTGATGAGG + Intronic
1082738623 11:56885270-56885292 TGCCATGGGCAGGATTCAAGTGG - Intergenic
1083611639 11:64007225-64007247 TGCAAGGGCCAGGAGTCCTGTGG + Intronic
1083871391 11:65490460-65490482 AGCCCAGGCCAGAGGTCATGGGG - Intergenic
1084256599 11:67947071-67947093 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1084396596 11:68915029-68915051 TGTCATGGCCAGTGTCCATGTGG + Intronic
1089151607 11:116368775-116368797 TGCAGATGCCAGGGGTCATGTGG - Intergenic
1091383234 12:76499-76521 TGACCAGGCCAGGGGTCATTGGG - Intronic
1092283318 12:7113832-7113854 TGGCATGGCCAGTGGAGATGTGG + Intergenic
1092426814 12:8381771-8381793 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1095661162 12:44738642-44738664 TGCCATGGGCCGTGGTCAGGGGG + Intronic
1097532288 12:60818361-60818383 TGCCCAGGCCTGGGGTCATGTGG + Intergenic
1097586648 12:61523458-61523480 TGGCTTGGCCAGGTGTGATGTGG - Intergenic
1099510401 12:83528977-83528999 TGCCATGGTCCTGGGGCATGAGG + Intergenic
1101926040 12:108972129-108972151 TGCCCCAGCCAGGGGTAATGAGG + Intronic
1102561072 12:113762658-113762680 TGCCATGGCAACGTCTCATGTGG - Intergenic
1102698915 12:114822288-114822310 TGCCTAGGCCAGGAATCATGTGG + Intergenic
1103275926 12:119712019-119712041 TGTCATGGCCAGGAGTCTGGTGG - Intronic
1105699101 13:22922469-22922491 TGCCATGTGCAGGGGTCCTTGGG - Intergenic
1106074048 13:26442001-26442023 TGGCATGGTCTGGGGACATGAGG + Intergenic
1107165288 13:37276314-37276336 TGCCAAGGTCAGGGGTCAATGGG + Intergenic
1108786557 13:53909971-53909993 TGCCATAGCCTGGGGCCCTGAGG + Intergenic
1109354613 13:61221670-61221692 TGCAATAGCCAGGGGTGAAGAGG + Intergenic
1112488272 13:99839422-99839444 TGCCTTGGCCAGAGCTCCTGAGG + Intronic
1113583319 13:111444690-111444712 TGCCATGGCAGGGGCTGATGTGG - Intergenic
1114618871 14:24082816-24082838 TTCCATGGCCAGGGGGCTGGGGG + Exonic
1117028955 14:51650845-51650867 ACCCGTGGCCAGGGGTCATTGGG + Intronic
1121981236 14:98456305-98456327 TGCCATGGGCACGTGTGATGTGG + Intergenic
1122092010 14:99347127-99347149 TGCCAGGGCCAGGTCTCCTGGGG + Intergenic
1122319690 14:100846320-100846342 TGCCTTGCCCAGGGGGCCTGGGG + Intergenic
1123700818 15:22913728-22913750 GGCCATGGCCAGGGGCAAGGAGG + Intronic
1124372105 15:29109884-29109906 TGCCAGGTCCAGGGGCCACGGGG - Intronic
1125464141 15:39934192-39934214 TGCCATGGCTGGGGGCCGTGGGG + Exonic
1126418941 15:48450731-48450753 TGCTATGGCCAGGTGTGATTTGG + Intronic
1127311576 15:57756183-57756205 TGCCATTGCCAGGGGTTCTGGGG + Intronic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1128776942 15:70327886-70327908 TGGCCTGGCCTCGGGTCATGTGG + Intergenic
1128945151 15:71814741-71814763 TGGCATGGCCATGGGTCCAGAGG + Intronic
1129118454 15:73379808-73379830 AGCCAGGGCCAAGGTTCATGGGG - Intergenic
1130984899 15:88838441-88838463 TGCAGAGGCCAGGGGTCTTGAGG + Intronic
1131316960 15:91347896-91347918 TGCCATGGCAAGGGAACATCTGG - Intergenic
1131994935 15:98124636-98124658 TGCCAGCTCCAGGGCTCATGAGG - Intergenic
1132032498 15:98450232-98450254 TCCCATGGTCTGGGCTCATGAGG - Intronic
1132461166 16:55643-55665 GGCCATGCCCAGGGGTACTGGGG + Intronic
1132685942 16:1162174-1162196 GCCCAGGGCGAGGGGTCATGGGG - Intronic
1133132341 16:3685048-3685070 TGCTGGGGCAAGGGGTCATGGGG - Intronic
1136302426 16:29344922-29344944 TGCCAGGGGCAGGGGTCTGGAGG - Intergenic
1139365894 16:66433489-66433511 GGCCGTGGCCAGAGGTGATGGGG - Intronic
1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG + Intronic
1140927753 16:79599843-79599865 TTCCATGGCCAGGGGACTGGTGG + Exonic
1141523013 16:84593933-84593955 TGCCAGGGCCTGGGGGAATGGGG - Intronic
1141659002 16:85431616-85431638 TGCCATGGCCAAGTGTCTCGGGG - Intergenic
1142150270 16:88509584-88509606 TGCCAGGGCCAGGGCTCAGGTGG + Intronic
1142280538 16:89145539-89145561 TGCCCTGGCCAGGGAACATGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143103969 17:4519341-4519363 CACCATGGACAGGGGTCCTGGGG + Intronic
1143406928 17:6683896-6683918 TAGAATGGCCAGGGGTAATGGGG - Intergenic
1144191456 17:12850487-12850509 GTCCATGGGCAGGGGTCATGGGG + Intronic
1144728055 17:17511626-17511648 TGCACTGGCCAGGGCTGATGGGG + Intronic
1147318641 17:39633035-39633057 GGCCAAGGCCAGGGGTTCTGGGG - Intronic
1149802047 17:59578721-59578743 TGCCAAGGGCTGGGGTCAAGAGG - Intronic
1151635066 17:75341509-75341531 TTCCATCACCAGGGGTCAGGAGG - Intronic
1152198089 17:78929285-78929307 TGCCCTGGGCATGGGGCATGCGG - Intergenic
1152436232 17:80278126-80278148 TGCCGGAGCCAGGGGTCATTTGG + Intronic
1152722620 17:81930272-81930294 TACCATGGACAGGGGTCAGCCGG + Intergenic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1153497126 18:5710855-5710877 GGCCATGGCCAGGTGACAGGTGG + Intergenic
1153914174 18:9731466-9731488 TGGCTTTGCCAGTGGTCATGAGG + Intronic
1155363017 18:25021016-25021038 TGCCCTGGCCAGGGGTATTGGGG - Intergenic
1156557765 18:38086776-38086798 AGCCATGGCCCCAGGTCATGGGG - Intergenic
1157427358 18:47595332-47595354 TGCTGAGGCCAGGGGTCTTGTGG - Intergenic
1157508508 18:48250131-48250153 TGACATGCGCAGGGGTCAAGTGG + Intronic
1157624574 18:49040347-49040369 TGACCTGGCCAAGGGTCTTGGGG + Intergenic
1157862508 18:51153840-51153862 AGCCCTGGCCTGGGGGCATGGGG - Intergenic
1158350883 18:56563536-56563558 TGCCATGGGAAGGGGGCCTGCGG + Intergenic
1161108113 19:2454723-2454745 TGCCATGGGTTGGGGTCCTGGGG - Intronic
1161236597 19:3201385-3201407 TGCTGTGGGCAGAGGTCATGGGG + Intronic
1161389524 19:4013974-4013996 TGCCAGGGCCAGGGGTGACCAGG + Intronic
1162389708 19:10381979-10382001 TGCCATGGCCAAGGGACATGTGG + Intergenic
1163402651 19:17103546-17103568 TGCCAGGGCCTGGGGTGATGAGG + Intronic
1163552739 19:17974497-17974519 TTCCCTGGCCAGGTGTCAAGGGG + Intronic
1163741498 19:19016412-19016434 GGCCATGTGCAGGGGTCATGGGG + Intronic
1165232378 19:34395170-34395192 TGCCATGACCAGGGCCCAGGTGG + Intronic
1165232622 19:34396536-34396558 TCCCATGGGCTGGGGTCATGTGG + Intronic
1165403826 19:35618256-35618278 TGGCTGGGCCAGGGGTCCTGAGG - Intronic
1166702151 19:44888448-44888470 TGGCCTGGCCAGAGGTCAGGGGG - Exonic
1166720752 19:44994531-44994553 TGCCATGGCCTGTGGACCTGTGG - Intergenic
1167104005 19:47419878-47419900 GGCCATCTCCAGGGGTCACGTGG + Intergenic
1167579383 19:50332857-50332879 TTCCAGGGCCTGGGGTAATGGGG - Intronic
1168032474 19:53691669-53691691 TGACTTGGCCAGGCATCATGGGG + Intergenic
1168037017 19:53727983-53728005 TGACATGGCCAGGCATCATGGGG + Intergenic
1168041599 19:53763418-53763440 TGACATGGCCAGGCATCATGGGG + Intergenic
925125090 2:1448605-1448627 TGCCATGGCCAGGAGCCAAGAGG - Intronic
925183774 2:1833380-1833402 GGCCATGACCAGGGACCATGAGG - Intronic
926204858 2:10828791-10828813 GGCCAGAGCCAGGGGTCATTTGG - Intronic
926678013 2:15642761-15642783 TGACATGGCCAGCTGTCCTGGGG + Intergenic
927688300 2:25188344-25188366 TGTGATGGCCAGGGCTCCTGAGG - Intergenic
928053044 2:28021318-28021340 TGGCAGAGCCATGGGTCATGTGG + Intronic
929598055 2:43188400-43188422 TGCCAGGGCCAAGGGTCTTTAGG + Intergenic
931238560 2:60432690-60432712 TGCCATGCCCAGCAGCCATGTGG + Intergenic
934613063 2:95754986-95755008 TGCCATGGCGTGGGGACTTGTGG + Intergenic
934713546 2:96530473-96530495 TGCAATGGCCTGGGGTCAGCTGG - Intergenic
934934965 2:98458778-98458800 AGGCATGGCCAGGGGGGATGTGG + Intronic
937137196 2:119563848-119563870 TGCCATGGGCTGGGGACAAGAGG + Intronic
938177302 2:129145042-129145064 TTTCATGGACAGGGGTGATGGGG + Intergenic
938240461 2:129739001-129739023 CACCATGGGCAGGCGTCATGGGG + Intergenic
938418294 2:131122889-131122911 CCCCATGGTCAGGGGACATGGGG + Intronic
941360618 2:164546888-164546910 ACCCATGGCCAGGGGACCTGTGG - Intronic
946903642 2:224395782-224395804 TGCAATGGCAAGAGGTCATGTGG + Intronic
948015838 2:234689993-234690015 TGCCATGGCCTGGGGATTTGAGG - Intergenic
948200913 2:236129212-236129234 TGGCCTGGCCTGGGGGCATGGGG - Exonic
1169951915 20:11054444-11054466 TGCCATGGGAAGGTGTAATGAGG + Intergenic
1170556325 20:17518045-17518067 TGCCAGGGCCAGGAATCAGGAGG - Intronic
1171087015 20:22247073-22247095 TGGCAGGTGCAGGGGTCATGGGG - Intergenic
1173893138 20:46528922-46528944 TGCCATGGACTGGGGGCATTTGG - Intergenic
1174346585 20:49934951-49934973 TGCCAGGGCCTGGGGGTATGGGG + Intergenic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175437969 20:58967994-58968016 TGCCATGGCCAGGTGAGATCAGG + Intergenic
1176108579 20:63400896-63400918 TGGCACAGCCAGGGGGCATGGGG + Intergenic
1176134986 20:63518606-63518628 AGCCATGGCCAGGGGCCAGTCGG + Intergenic
1176281946 20:64318288-64318310 TGACCAGGCCAGGGGTCATTGGG + Intergenic
1177364079 21:20111424-20111446 TGCCATGGACAGGAGTTAGGTGG + Intergenic
1178394804 21:32233789-32233811 TGCCATGGCCAGGGGCAGAGTGG - Intergenic
1179573588 21:42292475-42292497 TGCCCTAGGCAGGGGTCCTGGGG - Intronic
1179707960 21:43193546-43193568 CTCCATGGCCAGGGGACCTGGGG + Intergenic
1181131097 22:20732843-20732865 AGCCAAGGCCAGGGCTCAGGGGG + Intronic
1181570756 22:23766896-23766918 TGGCTAGGTCAGGGGTCATGAGG - Intronic
1182146703 22:28001168-28001190 AAGAATGGCCAGGGGTCATGAGG + Intronic
1183237422 22:36630104-36630126 GACCATGGGAAGGGGTCATGTGG + Intronic
1183386913 22:37519883-37519905 AGCAATGGGCAGAGGTCATGGGG + Intergenic
1184098396 22:42328958-42328980 GGCCTGGGCCTGGGGTCATGTGG - Intronic
1184424881 22:44403482-44403504 TGCCATCCCCTGGGGTCCTGGGG - Intergenic
1184786381 22:46673965-46673987 TGCAGGAGCCAGGGGTCATGAGG + Intronic
950188035 3:10957425-10957447 TCCCATGGCCAGCGGGCCTGTGG - Intergenic
950577770 3:13843042-13843064 TGCCATGGCTTGGTGTCCTGTGG + Intronic
952439536 3:33311856-33311878 GGCCAAGGCGAGGGATCATGGGG - Intronic
954279320 3:49564799-49564821 TGCCATGGCTAGGGTGCAAGGGG - Intronic
955045821 3:55358598-55358620 AGCACTGGCCTGGGGTCATGTGG + Intergenic
957071500 3:75571087-75571109 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
959704673 3:109329078-109329100 TGCCATTGCCAGGTGTCAGGTGG - Exonic
960386870 3:117030963-117030985 AGGCAAGGCCAGGGGACATGTGG + Intronic
961282627 3:125775654-125775676 AGCCAGGGCCAGGGGGCATTGGG + Intergenic
961771914 3:129256243-129256265 TGCTATGGCCAGGGGTCACAAGG - Intronic
963411883 3:144938932-144938954 AGCCATGGTCAGGGATTATGGGG - Intergenic
968532265 4:1098748-1098770 TGCCATGGCCGGGGCTGAGGGGG - Intronic
968548927 4:1212669-1212691 TGCCATGGGCACGGGGCCTGTGG - Intronic
968549282 4:1214034-1214056 CTCCATGGCCAGGGCCCATGGGG + Intronic
968958636 4:3731513-3731535 TGACGTGGCCAGGAGCCATGGGG - Intergenic
969015109 4:4098778-4098800 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
969045964 4:4336960-4336982 TGCCAGGGGCTGGGGTCAGGGGG + Intergenic
969184510 4:5465399-5465421 TGCCATGACCTGGGGGCAGGAGG - Intronic
972689899 4:41386682-41386704 TTCCATGACCTGGCGTCATGTGG + Intronic
972702175 4:41504562-41504584 TGCCATTGCCAGGGAGCATTTGG - Intronic
977670828 4:99693140-99693162 TGCCATGCCCTGGGGTGATCAGG - Intergenic
979396152 4:120191977-120191999 TGCCATCTCCAGGGATCACGAGG + Intergenic
981873730 4:149516626-149516648 TCCCATAGCCAGGATTCATGGGG + Intergenic
984452072 4:179914733-179914755 GGCCAAGGCAGGGGGTCATGAGG + Intergenic
985387637 4:189463880-189463902 TCCTGTGGCCAGGGGACATGTGG - Intergenic
992062544 5:73069271-73069293 TTCCATGGACTGGGGTCAAGAGG + Intronic
998174341 5:139892438-139892460 TACCAGGCCCTGGGGTCATGTGG + Intronic
998184252 5:139966681-139966703 TGGCATGGTCAGGGGTGATGAGG + Intronic
999233303 5:150075432-150075454 TGCCATGTTCAGGGGACAAGTGG - Intronic
999326204 5:150645262-150645284 TGCCATGGCCAGTGCTAATGAGG + Intronic
1001209092 5:169793711-169793733 TGCCAGGGCCAGGTCTCATCAGG - Intronic
1001997479 5:176173878-176173900 TCCCAGGGCCCGGGGGCATGGGG - Intergenic
1002279564 5:178122485-178122507 TCCCATGGCCAGTGGTCAGTGGG + Exonic
1003124970 6:3348845-3348867 TGCCCTGGCTCTGGGTCATGGGG - Intronic
1003172869 6:3733827-3733849 TGCCATGGGAAGGGGTCAGGTGG - Intronic
1003507035 6:6748630-6748652 GGCCATGGCCATGGAGCATGTGG + Intergenic
1005784514 6:29229435-29229457 TGCAAAGGCCTGGGGACATGTGG - Intergenic
1005920667 6:30397873-30397895 TGCCAGGCCCAGGGGCCCTGGGG + Intergenic
1006817011 6:36858508-36858530 AGCCATGCCCAGGGGCCTTGGGG - Intronic
1007472732 6:42101429-42101451 TGCCATGAACAGGAGTCATGTGG + Exonic
1010251020 6:73707195-73707217 TGCCATGGCCATGGGAGTTGGGG + Intronic
1010991776 6:82487258-82487280 TGCTAAGGCCTGGGGACATGTGG + Intergenic
1011857328 6:91710538-91710560 TGGCATGGGGAGGGGCCATGTGG - Intergenic
1013276677 6:108592102-108592124 AGCGATTGCCAGGGGTGATGGGG + Intronic
1013306927 6:108856732-108856754 AGCCATGGCAATGGGTTATGAGG + Intronic
1015166912 6:130208810-130208832 TTCCAAGGACAGGGGTCAGGGGG - Intronic
1018540694 6:164876319-164876341 TGACATGTCTAGGGGTCCTGTGG + Intergenic
1019136029 6:169908124-169908146 GGCCATCGCCAGGGGCCCTGGGG + Intergenic
1019317148 7:391975-391997 TGCCAAGCCCAGGGGGCCTGAGG - Intergenic
1019411001 7:906750-906772 GGACATGGACAGGGGACATGGGG + Intronic
1019689053 7:2399701-2399723 TCCCAGGGCCAGAGGTCATCAGG + Intergenic
1023183153 7:37506263-37506285 TGACATGACCAGAGGTCTTGGGG + Intergenic
1023755038 7:43408345-43408367 TGCCTTTGCCAGGGGTTAGGAGG + Intronic
1023871802 7:44267210-44267232 GACCTTGGCCAGGGGTCTTGGGG - Intronic
1024358333 7:48442057-48442079 TACCATGGCCAGTGCCCATGGGG + Intronic
1024358473 7:48443405-48443427 TGCCATGGCCAGTGCCCGTGGGG - Intronic
1024634983 7:51279787-51279809 TGCTGTTGCCAGGGGTCAGGAGG - Intronic
1026190698 7:68123627-68123649 AGCCATGGCCACGTTTCATGAGG + Intergenic
1027185429 7:75968164-75968186 TCCCCTGGCCAAGGGGCATGAGG - Intronic
1029570127 7:101363421-101363443 TGCCAGGGGCAGGGGACACGGGG + Intronic
1031475909 7:122221420-122221442 TGCCATGGCCAGGGGATACGAGG - Intergenic
1032023311 7:128421918-128421940 TCACATGGCCTGGGGTCATCAGG - Intergenic
1032055597 7:128681889-128681911 AGCCATGGCCAGGGGGGTTGTGG - Intronic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1034807878 7:154104566-154104588 TGGCATGGACATGGGACATGTGG + Intronic
1035205070 7:157289799-157289821 AGCCCTGCCCAGGGGGCATGGGG + Intergenic
1036256878 8:7213193-7213215 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1036308928 8:7671792-7671814 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1036360610 8:8074320-8074342 AGCCAGGGCCAGGGGGCATTGGG + Intergenic
1036890361 8:12592647-12592669 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1036897929 8:12650564-12650586 AGCCAGGGCCAGGGGGCATTGGG - Intergenic
1038356155 8:26831412-26831434 TGCCATGGCCAGTGCTCAAGTGG + Intronic
1039099981 8:33930485-33930507 TGCCATGGGCAGTGGTCACTAGG + Intergenic
1039895915 8:41716391-41716413 TGCCTGGGCCAGGTCTCATGGGG + Intronic
1041179575 8:55233568-55233590 TCACATGGCCAGGGGCCATGAGG + Intronic
1042201757 8:66285452-66285474 TGCCATGGACAGGGCTCCAGGGG - Intergenic
1044992085 8:97805082-97805104 TGCCTGGGCCAGGGGGAATGAGG + Intronic
1046526674 8:115389679-115389701 TTCCATGGACTGGGGTCAGGGGG + Intergenic
1046554615 8:115759456-115759478 TGAAATGGCCAGGAGTCATTTGG - Intronic
1048480253 8:134783470-134783492 TTCCATGGACAGGGGTAAGGGGG - Intergenic
1048970748 8:139643766-139643788 GGCTTTGGCCAGGGGTCCTGGGG - Intronic
1048979382 8:139694891-139694913 TGCCCTTGCCTGGGGTCTTGGGG - Intronic
1049031350 8:140040343-140040365 TGCCAAGGTCAGTGGTCAAGTGG + Intronic
1049302641 8:141879732-141879754 TCCCATGGCAAGGGGACAAGAGG - Intergenic
1049434604 8:142580552-142580574 TGCCATGGTCAGAGGGCCTGAGG - Intergenic
1049485330 8:142855325-142855347 TCCAATGACCAGGGGTGATGAGG - Intronic
1049595403 8:143481108-143481130 TTCCAAGGCCTTGGGTCATGTGG + Intronic
1051421239 9:16891339-16891361 TGCCAGGGCCTGGGGTCAGAAGG + Intergenic
1055458900 9:76497994-76498016 TGCCAGGGGCTGGGGACATGGGG - Intronic
1056275053 9:84986302-84986324 TTCCATGGACAGGGGTTGTGAGG + Intronic
1056822473 9:89853368-89853390 AGCCCTGGCCAGGAGGCATGGGG - Intergenic
1057313061 9:93953653-93953675 TGCGGTGGCCAGGAGTCATCTGG + Intronic
1061896245 9:133649735-133649757 CACCTTGGCCAGGGCTCATGGGG + Intronic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1062465308 9:136678227-136678249 TGCTGTGGCCAGGGCTCAGGTGG - Intronic
1190333605 X:49250007-49250029 TCCCATGGCCAGGCCTCGTGTGG - Intronic
1190582314 X:51901230-51901252 TTCCAGGGCCTGGGGTCAGGAGG - Intronic
1194322065 X:92460730-92460752 TGCCAGGCCCAGGAGTAATGAGG + Intronic
1194672905 X:96756287-96756309 TGCCAGGGCCAGGGGAGAAGAGG - Intronic
1194826936 X:98576122-98576144 TGGCAAGGCCTGGGGACATGTGG - Intergenic
1197121489 X:122898352-122898374 TCCCATGGCCTGGGGTAGTGGGG - Intergenic