ID: 1139372055

View in Genome Browser
Species Human (GRCh38)
Location 16:66475099-66475121
Sequence GCTTATGTGAAGTGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139372051_1139372055 7 Left 1139372051 16:66475069-66475091 CCAAGGTATCGGGGTAAACAGGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1139372055 16:66475099-66475121 GCTTATGTGAAGTGGGAAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139372055 Original CRISPR GCTTATGTGAAGTGGGAAGC AGG Intronic
900555971 1:3280750-3280772 TCCTAGGTGAAGTGAGAAGCAGG + Intronic
900847331 1:5114433-5114455 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900848025 1:5119182-5119204 GCTTATAAGATGAGGGAAGCAGG + Intergenic
901843155 1:11966230-11966252 TCCTGTGGGAAGTGGGAAGCAGG - Exonic
902928430 1:19713316-19713338 GCTCATGTGTAGTGGGCAACAGG + Intronic
903512672 1:23888067-23888089 CATTATGTGAAGCAGGAAGCAGG - Intronic
903668190 1:25020815-25020837 GCTTCTGTGCAATGGGCAGCAGG - Intergenic
905631086 1:39518924-39518946 GCTTCTGTAAAATGGGAACCTGG + Intronic
905666675 1:39767252-39767274 GCTTCTGTAAAATGGGAACCTGG - Intronic
910999755 1:93150716-93150738 GCTAATATGAAATGGGAGGCTGG - Exonic
914958680 1:152187434-152187456 GCTGATGTGAATATGGAAGCTGG + Intergenic
916463215 1:165047745-165047767 GTTTTTCTGAAGTGGGAAGAGGG - Intergenic
919271254 1:195349524-195349546 GAATATGTGAAGTTGGCAGCAGG + Intergenic
919934426 1:202242081-202242103 GCTCAGGTGACGTGGGAAGGAGG + Intronic
920908682 1:210194007-210194029 GCTTATCAGTAATGGGAAGCTGG - Intergenic
921892053 1:220363595-220363617 GCTTATGTGCCGTGGGCAGACGG + Intergenic
923280400 1:232437908-232437930 GGTCATGTGGAGTGGGAAGATGG + Intronic
924441889 1:244093056-244093078 GCTTATGTGAATTGAAAGGCAGG - Intergenic
924672603 1:246144815-246144837 TCTTCTGTGAAGTGGGAACATGG - Intronic
1063116321 10:3074415-3074437 CCTTGGGTGAACTGGGAAGCAGG + Intronic
1063737219 10:8772379-8772401 ACTTATGAGAAATGGGAAGTTGG + Intergenic
1064849249 10:19692331-19692353 GCGTATGTGAAGTCTGTAGCAGG - Exonic
1066493761 10:35920345-35920367 GTTTATATAAAGTGGGAGGCTGG + Intergenic
1069688442 10:70334346-70334368 GCTGAAGTGAAGTAGGAAGCTGG + Intronic
1071472461 10:85993310-85993332 GCAGATGTGTAGTGGGGAGCAGG + Intronic
1071482599 10:86076534-86076556 GCTCATGTGATGGCGGAAGCTGG + Intronic
1071785944 10:88899874-88899896 GCTTATGGGGAATGTGAAGCCGG - Intronic
1073573425 10:104600231-104600253 GCTTCTGTGATGTGTGAAGCTGG + Intergenic
1073866278 10:107808040-107808062 GTTTCTGTGAAGTGTAAAGCAGG + Intergenic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1077823637 11:5779213-5779235 GCTCATCTTAAATGGGAAGCAGG + Intronic
1077838258 11:5944355-5944377 GCCTATGAGCTGTGGGAAGCAGG + Intergenic
1077895793 11:6452306-6452328 GCTTAGCTAAAGTGGGAAGGAGG - Intronic
1082919936 11:58482049-58482071 ACTTATAAGAAGTAGGAAGCTGG + Intergenic
1083259973 11:61517622-61517644 GCGTATGAGGTGTGGGAAGCTGG + Intronic
1083542022 11:63518136-63518158 GCGTTTATGAAATGGGAAGCAGG + Intergenic
1084492210 11:69485076-69485098 GCGTATGGGAAGTGGGGGGCGGG + Intergenic
1085680160 11:78565856-78565878 GCTTATGTGATTTGTTAAGCAGG - Intronic
1088060933 11:105648942-105648964 GCTTATGAGAAGTAGGACGGAGG + Intronic
1088861253 11:113801814-113801836 GCTTATCAGAAGTGGGAACCAGG - Intronic
1088943109 11:114480490-114480512 GCTTTTCTGAAGAAGGAAGCTGG + Intergenic
1089883551 11:121797630-121797652 GGTTAGGTGAGGAGGGAAGCAGG + Intergenic
1094259320 12:28474947-28474969 TCTTTTGGGAAGTGGGAAACTGG + Intronic
1097585021 12:61504933-61504955 CCTTTTCTGTAGTGGGAAGCAGG - Intergenic
1099226970 12:79981397-79981419 GCAAATGTAAAGTAGGAAGCAGG + Intergenic
1100273047 12:93044475-93044497 CCTTATGTCACGTGGGAAGTAGG - Intergenic
1101522397 12:105496023-105496045 GCATCTGTGAAGTTGGAAGCTGG + Intergenic
1104234228 12:126917471-126917493 GCTTATGAACAGTGGGAAACTGG + Intergenic
1106480889 13:30136052-30136074 GCAGATGTGTAGTGGGCAGCTGG + Intergenic
1110385901 13:74910555-74910577 GCTTATGGGAAGGAAGAAGCAGG - Intergenic
1115005320 14:28475688-28475710 GCTTATGGGAAGTTTGAAGCAGG + Intergenic
1116807037 14:49504163-49504185 GGTTATGTAAAGAGGGAACCAGG + Intergenic
1117748649 14:58897967-58897989 CCATCTGTGAACTGGGAAGCAGG - Intergenic
1120763800 14:88309960-88309982 GCTGGTGTCAAGTGGGAAGGGGG - Intronic
1120882273 14:89422815-89422837 GCTTACTTTAAGAGGGAAGCAGG + Intronic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1126154953 15:45557172-45557194 GCTTATGTGATGGTGGCAGCTGG + Intergenic
1127760720 15:62136875-62136897 GCTGATGGGCAATGGGAAGCAGG + Intergenic
1128130554 15:65224532-65224554 GCATATGTGATGTGGGCAGTGGG + Intergenic
1128254154 15:66184869-66184891 GTTTGGGTGAACTGGGAAGCAGG - Intronic
1129890057 15:79065896-79065918 GTGTATGTGAAGTGGGGGGCGGG + Intronic
1130041342 15:80407248-80407270 GCTGTTGTGAAGTGGTCAGCTGG - Intronic
1130883434 15:88074150-88074172 TCTTCTGTGAAGTGGGAAGTGGG - Intronic
1132308057 15:100831987-100832009 GCTGAGGTGTGGTGGGAAGCTGG + Intergenic
1133231450 16:4368961-4368983 CCTTATGAGAGGTGGGAAACAGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134212045 16:12285965-12285987 GCTACTGTGGAGGGGGAAGCAGG - Intronic
1134276302 16:12779640-12779662 GCTTATGTGCTTTGGGAGGCCGG - Intronic
1135493997 16:22935787-22935809 GCTTATGTGCAGTAGGCTGCTGG - Intergenic
1135936683 16:26786378-26786400 GATTATGTGAAGGGGGAAGGGGG + Intergenic
1136772972 16:32857618-32857640 GTTTCTGTGGAGTGGGGAGCTGG + Intergenic
1136897642 16:34003901-34003923 GTTTCTGTGGAGTGGGGAGCTGG - Intergenic
1137544335 16:49390092-49390114 GCTTGTTTGCAATGGGAAGCTGG + Intronic
1138911969 16:61411883-61411905 GCTCATGTGCAGTGGTAAGGGGG - Intergenic
1139346003 16:66304338-66304360 GCTGAGCAGAAGTGGGAAGCGGG - Intergenic
1139372055 16:66475099-66475121 GCTTATGTGAAGTGGGAAGCAGG + Intronic
1140858859 16:79001745-79001767 GCGTTTGTGCAGTGGGAAGTTGG + Intronic
1141559051 16:84854588-84854610 GGTTGTGTGCTGTGGGAAGCGGG - Intronic
1142155688 16:88531983-88532005 TCTTCTGTGGGGTGGGAAGCAGG - Exonic
1203075397 16_KI270728v1_random:1119728-1119750 GTTTCTGTGGAGTGGGGAGCTGG + Intergenic
1142942408 17:3392744-3392766 ACTTATGTGAAGTTCAAAGCAGG + Intergenic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1145002397 17:19314476-19314498 GCTGGTGTGAACTGGGAAGCAGG + Intronic
1146135440 17:30316793-30316815 GCATATGTGAAGTGGGTAGTAGG - Intronic
1146287670 17:31585222-31585244 GCATCTGTGAAATGGGCAGCTGG - Intergenic
1147938583 17:44028743-44028765 GGATATGTAAAGTGGGAGGCGGG + Intergenic
1149101965 17:52917978-52918000 TCATATGTCAAGTGAGAAGCTGG + Intergenic
1150495878 17:65607452-65607474 TCTTATGAGAAGTGGGTATCTGG + Intronic
1150846029 17:68659059-68659081 GCTTCTGTGGAGTGGGGAGAAGG - Intergenic
1151686876 17:75652666-75652688 GCTTATGGGAAGTGGATAGCAGG + Intronic
1154175604 18:12086026-12086048 GCTCCTGTGGAGTGGGGAGCTGG + Intergenic
1155028653 18:21964912-21964934 GCTCATGTGATGATGGAAGCTGG - Intergenic
1158341580 18:56472347-56472369 GCTTATGGAAAGTGTGAAGTAGG - Intergenic
1158566305 18:58556929-58556951 TCTTATGTGGAATAGGAAGCTGG - Intronic
1160003721 18:75052607-75052629 GATTATGTTAAGTGGGCAACTGG + Intronic
1164607805 19:29612596-29612618 GGCTATGTCAAGTGGGCAGCTGG - Intronic
1165768210 19:38363918-38363940 GGTTTTGTGGAGTGGAAAGCGGG - Intronic
925328243 2:3039267-3039289 TCTCATGTGAAGTGGGCATCAGG - Intergenic
926697772 2:15782634-15782656 GCCAAGGGGAAGTGGGAAGCAGG + Intergenic
926898549 2:17722913-17722935 GGAAATGTGAAGTGGGAAGTTGG - Intronic
927397816 2:22674307-22674329 ACTAGTGTGAAGTGGGAGGCAGG + Intergenic
928642795 2:33318298-33318320 GTTCAAGTGAAGTGGGAAGTAGG + Intronic
930712501 2:54562216-54562238 GCTGATGTGAAGTGGAGAGATGG - Intronic
932136772 2:69238089-69238111 GGGAATGTAAAGTGGGAAGCTGG - Intronic
932225954 2:70040934-70040956 GCTTATAGGAAGTGGGAAGAGGG - Intergenic
933096514 2:78189966-78189988 GCTTCTGTGAAGTGGAGAGTAGG + Intergenic
933615078 2:84475352-84475374 GCTTTTGGGAAATGGGAAGAGGG - Intergenic
933705116 2:85283880-85283902 GCCCACGTGAAGTGGGCAGCGGG - Intronic
935545643 2:104396988-104397010 TCTTATATAAACTGGGAAGCAGG - Intergenic
936558990 2:113520199-113520221 GCTTAATTAAAGTGGGAAGCAGG + Intergenic
941069022 2:160935485-160935507 GCTTAGGTGATTTGGGGAGCTGG + Intergenic
941428979 2:165388853-165388875 GCCTATGTTAAGAGGGAAGTTGG + Exonic
941479789 2:165992176-165992198 GCCTATGTTAAGAGGGAAGTTGG - Exonic
941694850 2:168540051-168540073 GCATATTTGAAATGGGAATCTGG + Intronic
941837813 2:170045532-170045554 GCTTATGGGATCTTGGAAGCAGG - Intronic
942428975 2:175889328-175889350 GGTAATGTGAAGTGTGAAGGGGG - Intergenic
945671812 2:212811134-212811156 AATTATCTGATGTGGGAAGCAGG + Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
946733968 2:222735905-222735927 GCTTGGGTGAAGGGGAAAGCAGG - Intergenic
1169932672 20:10851247-10851269 GTTTATGGGAAGTAAGAAGCAGG - Intergenic
1170466700 20:16628862-16628884 GCTGATGTGAGGTAGGAAGGTGG - Intergenic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1171425287 20:25044939-25044961 GCATTTGTGAAGGAGGAAGCGGG + Intronic
1172331312 20:34077725-34077747 GCTTATGTTGAGTGGGAGGGTGG + Intronic
1173617144 20:44410712-44410734 TCTTCTGTAAAGTGGGGAGCAGG - Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1176260723 20:64178090-64178112 GCCTCTGTGAAGAGAGAAGCTGG - Intronic
1178283384 21:31304360-31304382 GCTTTTGTGAAAAGGGAATCAGG + Intronic
1181322237 22:22016927-22016949 GGTTATTGGAAGTGGGAAGGTGG + Intergenic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1185205161 22:49533620-49533642 GCTTAAGAGAAGTGGGCAGTGGG - Intronic
952954987 3:38551312-38551334 GCTTATGTCAAGTGGGAGGCTGG - Exonic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
955355188 3:58225199-58225221 GCTGAGGTCAAGTGGGGAGCTGG - Intergenic
959693662 3:109226404-109226426 TCTGATGTGGAGTGGGAAGTAGG + Intergenic
961173348 3:124814946-124814968 GCTGATGGGGAGTGGGGAGCAGG - Intronic
961689256 3:128656625-128656647 GCTAATGAGAAGTAGGAACCAGG + Intronic
962527642 3:136250804-136250826 GCTTATGTTAAGTGTTGAGCTGG - Intronic
963366134 3:144336864-144336886 TCTTATGTAAAGTTGGAAGAAGG + Intergenic
963966968 3:151382804-151382826 ACTTAGGAGAAGTGGAAAGCTGG - Intronic
964475152 3:157091329-157091351 GCTTATAGGAAAGGGGAAGCAGG + Intergenic
968335879 3:197913150-197913172 GCAGATGGGAAGAGGGAAGCAGG - Intronic
971908753 4:32765489-32765511 GCTTTTTTCAATTGGGAAGCAGG + Intergenic
975129500 4:70818512-70818534 GCTTCTGTCATGTGGGAAGGGGG - Exonic
975950316 4:79762451-79762473 GCTTAGGTGATGGGGGCAGCAGG + Intergenic
976756386 4:88502408-88502430 GCTTAAGTGAAGAGAGAGGCAGG + Intronic
977868025 4:102053226-102053248 TCTTTGGAGAAGTGGGAAGCTGG + Intronic
978662419 4:111143600-111143622 GCCTTTGTGAAGTGGGAATCAGG + Intergenic
978723822 4:111946707-111946729 GCTTATGTGATTGTGGAAGCTGG - Intergenic
985174988 4:187191273-187191295 GCTTATGGAAAATTGGAAGCAGG + Intergenic
985915376 5:2914368-2914390 GCTTTTGGCAAGTGGGAAGTTGG - Intergenic
987801385 5:22701163-22701185 GAATATGTGAAGTAGGCAGCTGG - Intronic
988415300 5:30939747-30939769 GGGTATGTGGAGTGGGAAGGAGG - Intergenic
990535662 5:56719456-56719478 GCTTAAGAGAATTGGGAAGTGGG - Intergenic
991955718 5:71994473-71994495 GCTAATGGGGAGTGGGAAGGAGG - Intergenic
996112484 5:119582149-119582171 GCTGATGTGTAGTGTCAAGCAGG + Intronic
996529285 5:124510651-124510673 GCTCATGTGTATGGGGAAGCCGG + Intergenic
997125412 5:131221832-131221854 GCTAATGGGAAGTGGGAAAAGGG - Intergenic
997203262 5:132025738-132025760 GCTGTGGTGGAGTGGGAAGCAGG - Intergenic
998074522 5:139224830-139224852 GCTTTTGTGGAGTGGAAAGGGGG + Intronic
1003885026 6:10513779-10513801 GCTTTTGTGAAGTGGTCAGCTGG + Intronic
1004421122 6:15470746-15470768 GCATATGTGAATTGGAATGCAGG + Intronic
1004422906 6:15487581-15487603 GGTGAAGTGAAGTGGGAAACTGG - Intronic
1004893929 6:20128183-20128205 GTTGATGTGAAGTAGGAAGGGGG - Intronic
1006997733 6:38277874-38277896 GCACATGTGAAATGGCAAGCAGG + Intronic
1007177667 6:39907949-39907971 TATGATGCGAAGTGGGAAGCTGG - Intronic
1014701644 6:124696257-124696279 GCGAATGTGAAGTGGGAGACAGG + Intronic
1019264080 7:102621-102643 GCATATCTGAAGCGTGAAGCCGG + Intergenic
1019550202 7:1598440-1598462 GCTTTTGGAAAGTGGGTAGCCGG + Intergenic
1020439914 7:8206350-8206372 GGTAATGTCAAGTGGGCAGCTGG - Intronic
1022152956 7:27627607-27627629 GCCTATTTTAAGTGGGAAGGTGG + Intronic
1022241987 7:28521330-28521352 GATTATCTGAAGTTGGAAGAGGG + Intronic
1022860986 7:34366690-34366712 GCAGATGTGCAGTGAGAAGCAGG - Intergenic
1024837098 7:53534285-53534307 TTTTATGTGAAGTGGGAGACAGG - Intergenic
1025823146 7:64990317-64990339 GCTTATATGTTGTGGGAATCAGG + Exonic
1028946655 7:96587504-96587526 GGTTATCTGAAGTGGAAAACTGG - Intronic
1030604361 7:111623433-111623455 ACTTATTTGATGAGGGAAGCAGG - Intergenic
1031785212 7:126021779-126021801 GCTTATGTGATTGTGGAAGCTGG + Intergenic
1032520629 7:132541256-132541278 TCTTATGGGGAGGGGGAAGCTGG - Intronic
1032622411 7:133549390-133549412 GTCTCTGTGAATTGGGAAGCCGG + Intronic
1034071682 7:148192042-148192064 GCTTCTGAGGAGTGGGAAGTGGG + Intronic
1034198251 7:149264371-149264393 GCTGATGTGAAGTTGGAGGAGGG + Intronic
1034326599 7:150240388-150240410 GCTGATGAGAAGTTGGAAGTTGG + Intergenic
1034766612 7:153728885-153728907 GCTGATGAGAAGTTGGAAGTTGG - Intergenic
1038408556 8:27340893-27340915 GCGTATGTGCAGTGGGGAGGGGG + Intronic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041946724 8:63452245-63452267 GCTTTTGTGATGTGGACAGCTGG - Intergenic
1046038243 8:108871015-108871037 GCTTGAATGAAGTGTGAAGCAGG + Intergenic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049893861 9:95982-96004 GCTTAATTAAAGTGGGAAGCAGG - Intergenic
1051113918 9:13672909-13672931 CCTTAAGAGAAGTGGAAAGCTGG - Intergenic
1053735087 9:41096066-41096088 GCTTAATTAAAGTGGGAAGCAGG - Intergenic
1054693295 9:68335331-68335353 GCTTAATTAAAGTGGGAAGCAGG + Intronic
1057645838 9:96874751-96874773 GCTCTTGTGAATTAGGAAGCAGG - Intronic
1057645997 9:96875785-96875807 GCTCACCTGAAGTGGGACGCGGG - Intergenic
1058510454 9:105712213-105712235 GGTTATTTAAAGTGGGAAGTCGG - Intronic
1059747764 9:117219632-117219654 GCTTCTGTGAGGTTGTAAGCTGG + Intronic
1059923543 9:119184566-119184588 GCATGTGTGGAGTGGGGAGCAGG - Intronic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1186121370 X:6365742-6365764 GCTTCTCTCAAGTGGAAAGCTGG + Intergenic
1187969298 X:24643784-24643806 GCTGAAATGAAGTGGGGAGCTGG - Intronic
1190155675 X:47990386-47990408 GACTATCTGAAGTGGGTAGCAGG + Intronic
1190981097 X:55457138-55457160 GCTCCTGTGAGGTGGGTAGCGGG + Intergenic
1190987600 X:55516042-55516064 GCTCCTGTGAGGTGGGTAGCGGG - Intergenic
1191928177 X:66338778-66338800 GCTTTTGTCAAGTGGGTAGATGG + Intergenic
1192091501 X:68162241-68162263 GGTTATGTGAAGGGGTATGCAGG + Intronic
1194235092 X:91372926-91372948 GCTTATGTGTAATGGCAAGTAGG - Intergenic
1194943174 X:100037210-100037232 ACTTTTGTGAAGTTGGAAGAGGG + Intergenic
1196141289 X:112265965-112265987 GCAGATTTGAAGTGGGAAGAAGG - Intergenic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1198464372 X:136891506-136891528 GATAATGTCAAGTGGGAAGTTGG - Intergenic
1198973435 X:142307303-142307325 GGCAATGTGAAGTGGGAAGTTGG + Intergenic
1200130164 X:153837973-153837995 GCTTATGTAAAGTTGCATGCTGG - Intergenic
1201431409 Y:13906554-13906576 GCTTTTTTGAAGATGGAAGCAGG - Intergenic
1202583986 Y:26405937-26405959 GCTCCTGTGGAGTGGGGAGCTGG - Intergenic