ID: 1139372428

View in Genome Browser
Species Human (GRCh38)
Location 16:66477368-66477390
Sequence TGCCATTGTCGTGTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139372428_1139372434 4 Left 1139372428 16:66477368-66477390 CCATGCCCAACACGACAATGGCA 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1139372434 16:66477395-66477417 CATTCTGGAGCTGTCACTGATGG 0: 1
1: 0
2: 2
3: 18
4: 201
1139372428_1139372437 29 Left 1139372428 16:66477368-66477390 CCATGCCCAACACGACAATGGCA 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1139372437 16:66477420-66477442 GAAGGCAGCTGTGCTTGGTGAGG 0: 1
1: 0
2: 1
3: 34
4: 343
1139372428_1139372435 11 Left 1139372428 16:66477368-66477390 CCATGCCCAACACGACAATGGCA 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1139372435 16:66477402-66477424 GAGCTGTCACTGATGGATGAAGG 0: 1
1: 0
2: 1
3: 21
4: 217
1139372428_1139372436 24 Left 1139372428 16:66477368-66477390 CCATGCCCAACACGACAATGGCA 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1139372436 16:66477415-66477437 TGGATGAAGGCAGCTGTGCTTGG 0: 1
1: 0
2: 4
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139372428 Original CRISPR TGCCATTGTCGTGTTGGGCA TGG (reversed) Intronic
902707231 1:18213883-18213905 GGCCTTTGAAGTGTTGGGCAGGG - Intronic
904747358 1:32719472-32719494 TGCCAGCCTTGTGTTGGGCATGG - Intergenic
911596527 1:99804332-99804354 AGCCATTGTTGTGTTGTGGATGG - Intergenic
919115304 1:193274175-193274197 TGATATTTTCCTGTTGGGCAAGG + Intergenic
920501567 1:206488551-206488573 TGCCATTGTGGGGTAGTGCAAGG + Intronic
921885571 1:220301796-220301818 GGCCATTGTCCTGTTTGGCCAGG - Intergenic
1065137427 10:22685811-22685833 TGCCATTGCTGTGAGGGGCATGG - Intronic
1066256668 10:33686093-33686115 TGGAATTGTCTTGTTGTGCAAGG + Intergenic
1069325548 10:67227482-67227504 TGATATTGTCCTGTTGGACAAGG - Intronic
1069881546 10:71596772-71596794 TGGACTTGCCGTGTTGGGCAGGG + Intronic
1071023986 10:81090910-81090932 TGACATTTTCCTGTTGGACAAGG + Intergenic
1071812125 10:89194301-89194323 TGATATTTTCGTGTTGGACAAGG + Intergenic
1072773894 10:98169634-98169656 TGTCATTGTTCTCTTGGGCATGG + Intronic
1073634631 10:105184729-105184751 TGCAATTGTGGTGATGGTCATGG - Intronic
1074807665 10:117069779-117069801 TGCCATTTTTCTGTTGGGCATGG + Intronic
1075173827 10:120141079-120141101 TGTCATTGTCAGTTTGGGCAAGG + Intergenic
1075326302 10:121534683-121534705 TGCCATTTTGGGGCTGGGCATGG - Intronic
1076699066 10:132260809-132260831 TGCCACTGTGGTGTTGGGCGTGG - Intronic
1077319203 11:1933584-1933606 TGCCATTTTCATGGTGGCCAAGG + Intronic
1078638986 11:13077921-13077943 TGCCATAGTCATTTTGGGAAAGG - Intergenic
1081878827 11:46430308-46430330 TGCCATTGTGGTTTTGTGCATGG - Intronic
1086299790 11:85414808-85414830 TGACATTTTCCTGTTGGACAAGG + Intronic
1088773236 11:113056727-113056749 TGCCATTAAGGTGTTGGCCAGGG - Intronic
1092656636 12:10691964-10691986 TGCCATTGTCTTTTTGTGGATGG - Intergenic
1093409007 12:18842949-18842971 TGACATTTTCCTGTTGGACAAGG + Intergenic
1098851026 12:75596241-75596263 CGCCATTGACATTTTGGGCAAGG + Intergenic
1103410670 12:120709804-120709826 TGCCATTGTGCTGTTGGGACTGG + Intergenic
1103411662 12:120716542-120716564 TGCCATTGTGCTGTTGGGACTGG + Intronic
1104043921 12:125148192-125148214 TGGGATTGTGGTGCTGGGCATGG + Intergenic
1111771307 13:92599632-92599654 TGCCATTATCCTGTTTAGCAAGG - Intronic
1113269736 13:108660484-108660506 TGATATTTTCCTGTTGGGCAAGG + Intronic
1116346963 14:43805920-43805942 TGACATTTTCCTGTTGGACAAGG - Intergenic
1117640043 14:57788195-57788217 TGGCATTTTCCTGTTGGACAAGG - Intronic
1118078912 14:62335591-62335613 TGCCTTATTCATGTTGGGCATGG - Intergenic
1120511846 14:85424701-85424723 AGCCCTTGTCTTGCTGGGCATGG - Intergenic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1122629566 14:103101341-103101363 TGCAATTGTCCAGCTGGGCATGG - Intronic
1124483162 15:30093456-30093478 TGCCATTCTTGTGCTGGGCTTGG + Exonic
1124489611 15:30145524-30145546 TGCCATTCTTGTGCTGGGCTTGG + Exonic
1124520417 15:30403761-30403783 TGCCATTATTTTGTTGGGCTTGG - Exonic
1124538240 15:30562458-30562480 TGCCATTATTTTGTTGGGCTTGG + Exonic
1124544703 15:30614518-30614540 TGCCATTGTTGTGCTGGGCTTGG + Exonic
1124747578 15:32351133-32351155 TGTCATTGCCGTGTTGCTCATGG + Intergenic
1124753917 15:32392803-32392825 TGCCATTATTTTGTTGGGCTTGG - Exonic
1124760413 15:32445127-32445149 TGCCATTATTTTGTTGGGCTTGG - Exonic
1124778223 15:32603935-32603957 TGCCATTATTTTGTTGGGCTTGG + Exonic
1126171710 15:45700773-45700795 TGCCTTTGTCCTGCTGGGCCTGG + Intergenic
1127194678 15:56570828-56570850 TGATATTTTCCTGTTGGGCAAGG - Intergenic
1130257077 15:82330797-82330819 TGCCAGTGTCGTGCTGTGCCCGG - Intergenic
1130366087 15:83240584-83240606 TGAAATTGTCGTTCTGGGCATGG + Intergenic
1130597873 15:85259193-85259215 TGCCAGTGTCGTGCTGTGCCCGG + Intergenic
1130823661 15:87521201-87521223 TGCCATTGTCATGTAGGAAATGG + Intergenic
1131786712 15:95921328-95921350 TGCCAATGTCTTGTTGGGCATGG + Intergenic
1133617728 16:7494190-7494212 TGCAATTCTCGTTTTGAGCATGG + Intronic
1134472868 16:14542980-14543002 TGCAATTGTCCTGTTGGGGTTGG - Intronic
1137002417 16:35240928-35240950 TGCCATTATCATGCTGGGAATGG - Intergenic
1139372428 16:66477368-66477390 TGCCATTGTCGTGTTGGGCATGG - Intronic
1140483746 16:75277761-75277783 TGAGTTTGTTGTGTTGGGCAGGG - Intergenic
1140832516 16:78765031-78765053 TTCCACTGTCCTGTTGGGCAGGG - Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1141920682 16:87133574-87133596 GGCCTTGGTCGTGATGGGCAGGG + Intronic
1142237553 16:88929385-88929407 AGCCACTGTCCTGGTGGGCAGGG - Intronic
1143191311 17:5042141-5042163 TAGCATTCTCGTGTTGGGGATGG + Intronic
1144796754 17:17896612-17896634 TGCCAGGGTCCTGTTTGGCAGGG - Intronic
1150495806 17:65607077-65607099 TGGGATGGTGGTGTTGGGCAGGG + Intronic
1151836592 17:76586147-76586169 CGCCAGTCTCGGGTTGGGCAGGG + Intronic
1155547432 18:26929906-26929928 AGGCATTGGCATGTTGGGCAGGG - Intronic
1156392148 18:36660496-36660518 AGCCAGTGCCATGTTGGGCACGG - Intronic
1158756722 18:60333865-60333887 TGCTATTGGCCTGTTGGGCAAGG - Intergenic
925068121 2:945269-945291 TGCCATGGTGCTGGTGGGCATGG + Intergenic
931402980 2:61948974-61948996 AGCCATTGAAGTGCTGGGCACGG + Intronic
931548084 2:63410821-63410843 TGATATTTTCCTGTTGGGCAAGG - Intronic
937857697 2:126684479-126684501 TGCCAGTGTGGTAGTGGGCATGG - Intronic
941702316 2:168616665-168616687 TGACATTTTCCTGTTGGACAAGG - Intronic
943654495 2:190493311-190493333 TGAAATTTTCCTGTTGGGCAAGG - Intronic
944420912 2:199529169-199529191 TGATATTTTCGTGTTGGACAAGG - Intergenic
1173006734 20:39145565-39145587 TGGCTGTGTGGTGTTGGGCAAGG + Intergenic
1175704715 20:61168153-61168175 TGCCCTTGTCGAGTTGGGCATGG - Intergenic
1180250901 21:46587437-46587459 TGATATTTTCCTGTTGGGCAAGG - Intergenic
1181862619 22:25830618-25830640 TGTCCTTGTAGTGCTGGGCAGGG + Intronic
953222173 3:40982123-40982145 AGACATTGTCGGGCTGGGCATGG - Intergenic
955565187 3:60236664-60236686 TGCTATTGTCTTGTTTTGCAAGG + Intronic
956285524 3:67605862-67605884 TTGCATTGACGTGTTGGGCTGGG - Intronic
959722096 3:109503558-109503580 TGATATTTTCCTGTTGGGCAAGG + Intergenic
961744051 3:129052327-129052349 TGTCATTGTTGAGCTGGGCATGG + Intergenic
963850126 3:150202543-150202565 TGACATTGTCTTCTTGGGCGGGG + Intergenic
965085863 3:164097018-164097040 TTCCATTGTCCTTTTGGGAATGG - Intergenic
968494901 4:910166-910188 TGTCAGTGCCCTGTTGGGCAGGG - Intronic
971027893 4:22606630-22606652 AGGCATTGGCATGTTGGGCAGGG - Intergenic
971182904 4:24347466-24347488 TGACATTTTCCTGTTGGACAAGG + Intergenic
986104360 5:4645554-4645576 TTTCATTGACGTGTTGGGGATGG - Intergenic
987558328 5:19484373-19484395 TGACATTGTGGTGTTGAGCAGGG - Intronic
995818033 5:116193601-116193623 TGACATTTTCCTGTTGGACAAGG - Intronic
996325620 5:122269481-122269503 TGACATTTTCCTGTTGGACAAGG - Intergenic
996657300 5:125956357-125956379 TGACATTTTCCTGTTGGACAAGG - Intergenic
996687376 5:126297538-126297560 TGCCATTGACGTGGTGGGTTGGG - Intergenic
999407947 5:151323881-151323903 TGGCATTATCATGTTGGGAAAGG + Intronic
1003331504 6:5133073-5133095 TACTGTTGTTGTGTTGGGCAGGG + Intronic
1008072299 6:47109993-47110015 TTCCGTTAACGTGTTGGGCACGG - Intergenic
1009495098 6:64336403-64336425 TGACATTTTCCTGTTGGACAAGG - Intronic
1012385359 6:98675126-98675148 TCCCATTGTCTTGTTTTGCAGGG - Intergenic
1016984569 6:149885347-149885369 TGCCTTTCTCCTGTTGGCCAGGG + Intronic
1020564977 7:9783847-9783869 TACCACTGTCCTGTTTGGCATGG - Intergenic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1030390240 7:108919050-108919072 TGATATTTTCCTGTTGGGCATGG + Intergenic
1034980961 7:155476046-155476068 TCACCTTGTCGTGTTGTGCAGGG - Intronic
1036389554 8:8312623-8312645 TGTCATTGTGGTGGTGGGAATGG + Intergenic
1040800455 8:51333747-51333769 TGATATTGTCCTGTTGGACAAGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1043391490 8:79796482-79796504 TGCCATTATTGTATTGGGCTTGG + Intergenic
1043870899 8:85431341-85431363 TCCCATTGTAATGTAGGGCATGG + Intronic
1045135948 8:99218627-99218649 TGCCATTGTCGTCTGGCACATGG + Intronic
1046215468 8:111140497-111140519 TGCCATGGTGGTGTTGGGTAAGG + Intergenic
1046971076 8:120223941-120223963 TGTCACTGAGGTGTTGGGCACGG - Intronic
1051277675 9:15413177-15413199 TGACATTTTCCTGTTGGACAAGG + Intergenic
1052201090 9:25781176-25781198 TACCATGGTGATGTTGGGCAGGG + Intergenic
1055514758 9:77023367-77023389 TGCCATTGTCATTCTGTGCATGG - Intergenic
1055690011 9:78819854-78819876 TGCCATTGTGGTGCTGTGAAAGG + Intergenic
1059085319 9:111295480-111295502 TAACTTTGTGGTGTTGGGCAGGG + Intergenic
1061757549 9:132826015-132826037 TGCCCTTGCCTTTTTGGGCAGGG + Intronic
1186648875 X:11537395-11537417 TGCCGTTGACATTTTGGGCAGGG - Intronic
1190840668 X:54141054-54141076 TGCCAGTGATGTGTTTGGCATGG - Intronic
1192017453 X:67346982-67347004 TGACATTTTAGAGTTGGGCATGG - Intergenic
1192938550 X:75887743-75887765 TGCCACAGTCGTTTTGGCCATGG - Intergenic
1194221602 X:91200279-91200301 GGCCATTGACGGGTTGGACAAGG + Intergenic
1197363108 X:125532151-125532173 TGCCATAGTGGTGGTGGCCACGG - Intergenic
1197965921 X:132061689-132061711 TGACATTGTAGTGTGGGGAATGG - Intergenic
1200415092 Y:2901242-2901264 TGACATTTTCTTGTTGGACAAGG - Intronic