ID: 1139373847

View in Genome Browser
Species Human (GRCh38)
Location 16:66484660-66484682
Sequence CAGGAGTACCAGATGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139373839_1139373847 22 Left 1139373839 16:66484615-66484637 CCTGGGATGAGGATGTGGGTGAG 0: 1
1: 0
2: 0
3: 49
4: 452
Right 1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 19
4: 267
1139373838_1139373847 23 Left 1139373838 16:66484614-66484636 CCCTGGGATGAGGATGTGGGTGA 0: 1
1: 0
2: 2
3: 36
4: 341
Right 1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 19
4: 267
1139373835_1139373847 28 Left 1139373835 16:66484609-66484631 CCAGACCCTGGGATGAGGATGTG 0: 1
1: 0
2: 1
3: 30
4: 313
Right 1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139373847 Original CRISPR CAGGAGTACCAGATGGAGTG AGG Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900136929 1:1121679-1121701 CAGGAGTCCCAGATGGGGTGGGG - Intergenic
900234163 1:1578733-1578755 CAGGTGTGCCAGCTGCAGTGGGG - Intergenic
900648200 1:3718401-3718423 CCGGAGACCCAGAGGGAGTGGGG + Intronic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
905133924 1:35783332-35783354 TTGGAGTCCCAGATGGAGAGGGG - Intergenic
907715626 1:56923431-56923453 GAGGAGGACCTGATGAAGTGTGG - Intergenic
907936743 1:59048510-59048532 CAGGAGCAAGAGAGGGAGTGGGG - Intergenic
909458571 1:75879701-75879723 CAGGGGTCAGAGATGGAGTGAGG + Intronic
910438700 1:87230869-87230891 CAGGAGCAGCTGGTGGAGTGAGG - Intergenic
910653245 1:89592575-89592597 CAGGAGTACAATGAGGAGTGAGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
915444631 1:155967675-155967697 GCGGAGAAGCAGATGGAGTGTGG - Intronic
915726183 1:158019335-158019357 CAGAAGGACCAGATGGATTCTGG + Intronic
917578199 1:176346088-176346110 CAGGAGGAAGAGATAGAGTGGGG + Intergenic
919523571 1:198619807-198619829 CAGGAGTACCAGAAACAGAGAGG + Intergenic
920528947 1:206687767-206687789 CAGGAGAGGAAGATGGAGTGGGG + Intronic
921897392 1:220414621-220414643 CAGGAGTAAGAGAGAGAGTGTGG - Intergenic
922007277 1:221544417-221544439 CAGGAGGACCACATGAAGTCTGG + Intergenic
922095594 1:222440471-222440493 CAGGAGTGCAAGAAAGAGTGGGG + Intergenic
923298157 1:232615169-232615191 CAGGGGCAGGAGATGGAGTGTGG - Intergenic
1064005181 10:11693680-11693702 CAGGAGGAACAGCTGGTGTGAGG - Intergenic
1064861437 10:19830588-19830610 CAGGAGAACAACATAGAGTGGGG - Intronic
1065252341 10:23828315-23828337 CAGCAATAGCAGATGGAGTAGGG + Intronic
1065894927 10:30154815-30154837 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1068008681 10:51420883-51420905 TAGGAGTAAGAGAGGGAGTGGGG + Intronic
1071475343 10:86020600-86020622 AGGAAGTAACAGATGGAGTGGGG + Intronic
1071724155 10:88179177-88179199 TGGGAGTACCAGATTGAGGGTGG + Intergenic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1075392742 10:122104596-122104618 CAGGAGGATCAGTTGGAGTCAGG - Intronic
1077220585 11:1413767-1413789 CAGGAGGGGCTGATGGAGTGGGG - Intronic
1077895827 11:6452528-6452550 CAGGACTAAGAGATGGAGTTGGG - Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1081755344 11:45540373-45540395 GAGGAAGACCACATGGAGTGAGG + Intergenic
1081797692 11:45832811-45832833 CAGGAGGACCTGATGTGGTGGGG - Intergenic
1081934558 11:46895946-46895968 CAGAAGTGCCAGATGGTGCGGGG - Exonic
1082944083 11:58739961-58739983 CAGGAGGCCCACATGCAGTGGGG + Intergenic
1086548610 11:88027998-88028020 GAGGAGTACCAGGCCGAGTGAGG - Intergenic
1087058362 11:93955185-93955207 CCAGAGCACCAGAGGGAGTGTGG + Intergenic
1087352084 11:97045506-97045528 GAGGAGTACCAGACCGTGTGAGG + Intergenic
1087726086 11:101719000-101719022 CAGGAGTCCCAGGTGCAGAGGGG - Intronic
1088187284 11:107185156-107185178 CAGCAGTACCAGATGGTGAGAGG + Intergenic
1088212925 11:107476074-107476096 CAGGTGTACCACACAGAGTGGGG - Intergenic
1089156186 11:116404544-116404566 GAGGAGAACCAGATGGACAGGGG + Intergenic
1089575085 11:119436491-119436513 CAGGAGTACAAGAAAGAGAGCGG + Intergenic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1092469452 12:8764959-8764981 CAGGAGGAGCAGGTGGAATGGGG - Intronic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1098991383 12:77067707-77067729 CAAGAGCCCCAGAGGGAGTGTGG - Intergenic
1099810794 12:87579727-87579749 CAGGATTTCCTGATGGATTGGGG + Intergenic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1102781690 12:115571077-115571099 CAGGAGGTCCAAAGGGAGTGGGG + Intergenic
1103281114 12:119758740-119758762 CAGGAGTAACAGGGGCAGTGCGG + Intronic
1103550302 12:121732307-121732329 GAGGAGGACAACATGGAGTGAGG - Intronic
1104651403 12:130537092-130537114 CATGAGGGCCAGATGCAGTGTGG + Intronic
1105287284 13:19014691-19014713 CAGGAGTTGGAGATGGAGTTGGG - Intergenic
1106326975 13:28701553-28701575 CAAGTGTACCAGCTGGAATGAGG - Exonic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107649874 13:42534535-42534557 CAGCAGCATCAGATGGATTGTGG + Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108411121 13:50148186-50148208 CAGGGGTGCCAGATGTAGAGTGG - Intronic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1110574199 13:77037369-77037391 CAGGAGAAACAGACTGAGTGGGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112086231 13:96034784-96034806 CAGGAGTGCCAGCTGCAGTGGGG - Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1113751369 13:112778645-112778667 GAGGAGTAGCCGCTGGAGTGAGG + Intronic
1113751455 13:112779238-112779260 CTGGAGTAGCCGCTGGAGTGAGG + Intronic
1113751458 13:112779257-112779279 GAGGAGTAGCCGCTGGAGTGAGG + Intronic
1113751468 13:112779311-112779333 GAGGAGTAGCCGCTGGAGTGAGG + Intronic
1114549244 14:23523750-23523772 CTGGGGTTCCAGATGGAATGGGG - Exonic
1116665161 14:47765398-47765420 CTGCAGTAATAGATGGAGTGGGG + Intergenic
1116977563 14:51132699-51132721 CTGGAGTACCAGAGGAAATGGGG + Intergenic
1117625755 14:57636139-57636161 CAGGAGAACCAGTAGGAGTTAGG + Intronic
1118776715 14:68978378-68978400 GAGAAGGACCAGCTGGAGTGCGG - Intronic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1124203640 15:27699081-27699103 CAGGAGTTACAGAGAGAGTGTGG - Intergenic
1125263635 15:37854706-37854728 CAGGAGCAACAGAGAGAGTGGGG - Intergenic
1128154565 15:65384625-65384647 CAGGAGTACCAGACTCAGTCAGG + Intronic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129600596 15:76996123-76996145 CAGAATTACCATTTGGAGTGAGG - Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1131201691 15:90402732-90402754 GAGGAATACAAGAGGGAGTGGGG + Intronic
1131817605 15:96237528-96237550 CACAAGTACCAGATGGAATTTGG + Intergenic
1132418917 15:101647519-101647541 CAGAAGCACCACATGGTGTGTGG + Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1135071066 16:19352094-19352116 CAGGATTTCCATATGGGGTGAGG + Intergenic
1135620360 16:23950314-23950336 CAGGAGCACCAGTTGGGGAGTGG - Intronic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1140310199 16:73841314-73841336 CAGAAGTACCAGATGAGCTGGGG + Intergenic
1141542587 16:84737537-84737559 CAGGAATGCCAGATGGGTTGTGG - Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143629597 17:8130460-8130482 CAGGAAAACCAGGGGGAGTGGGG + Intergenic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1147126019 17:38369298-38369320 CAAGAGAACCCGATGCAGTGTGG - Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1150210335 17:63438136-63438158 CAGGAGTTCCATATGCGGTGAGG + Intronic
1151890190 17:76947084-76947106 CAGGTGGCCCAGATGGAGCGTGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153557768 18:6334219-6334241 CAGGAGTCCCAGTTGGTGTCAGG + Intronic
1153952152 18:10067011-10067033 CAGGTGGACCAGCTGGGGTGTGG - Intergenic
1157750460 18:50173649-50173671 CAGGACTTGCTGATGGAGTGGGG + Intronic
1159328065 18:66949573-66949595 CAGCAGGACCAGACGGAGTTTGG - Intergenic
1160780186 19:874081-874103 CTGGAGTACCCGGTTGAGTGTGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161624057 19:5315698-5315720 CAGGAGTTCCAGATCAGGTGGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163759867 19:19130364-19130386 CTGGGGTCCCAGACGGAGTGTGG - Intronic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925289881 2:2740411-2740433 GAGGAACACCAGCTGGAGTGAGG + Intergenic
925289890 2:2740447-2740469 GAGGAGGACCTGCTGGAGTGAGG + Intergenic
925289926 2:2740627-2740649 GAGGAGCACCTGCTGGAGTGAGG + Intergenic
925289948 2:2740735-2740757 GAGGAGCACCTGCTGGAGTGAGG + Intergenic
925501813 2:4513334-4513356 CAGGAGTACAAGTTTGAATGTGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
926049790 2:9737516-9737538 GAGGAGTACTAGAGGGAGTAGGG - Intergenic
926049801 2:9737554-9737576 CAGGGGTACTAGAGGAAGTGAGG - Intergenic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
926049880 2:9737777-9737799 GGGGAGTACCAGAGGAAGTGGGG - Intergenic
926103127 2:10133351-10133373 CAGCAGTACCAGGTGAAGGGAGG - Intergenic
926758265 2:16253112-16253134 CAGCAGTACAAGATAAAGTGAGG + Intergenic
928224543 2:29436941-29436963 CAGGAGTGACAGAGGTAGTGAGG + Intronic
929048960 2:37818141-37818163 CAAGAGTATCAGATGAAGAGAGG + Intergenic
929826884 2:45315813-45315835 CAGGACTAACAGATTGGGTGGGG - Intergenic
930858669 2:56045930-56045952 CAGGGGAACCAGGTGAAGTGTGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
933525742 2:83436244-83436266 CAGGAGTACCACTTGAAGTCAGG + Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
936450695 2:112631925-112631947 CTGGGGTACCAGGTGGAGTCTGG - Intergenic
936492694 2:112986200-112986222 CAGGAGCAACAGAGAGAGTGAGG - Intergenic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
936721592 2:115257476-115257498 CAGGAGCAAAAGAGGGAGTGAGG + Intronic
937681854 2:124652620-124652642 AAGGAGGACAAGATGGAGAGGGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938463635 2:131513076-131513098 CAGAAGGACCAGGTGGTGTGGGG + Intergenic
938931512 2:136090226-136090248 CAGGGGTACCAGATGCAATTGGG + Intergenic
939109632 2:137991993-137992015 CATGAGAGCCACATGGAGTGGGG + Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940734205 2:157430451-157430473 CAGCATTACAAGACGGAGTGAGG - Intronic
940977917 2:159967080-159967102 CAAGAGTAGGAGATGGAGTCTGG + Intronic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943354814 2:186839895-186839917 CAGGAGTAGGAGATGGAAGGGGG - Intronic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1170747884 20:19116833-19116855 AAGGAGTAGCAGAGGAAGTGAGG - Intergenic
1171941451 20:31333468-31333490 GAGGAGTACCCGGTGGTGTGAGG - Intergenic
1172142350 20:32732297-32732319 CAGGAGTTCCAGATGAGCTGGGG - Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1172904624 20:38359893-38359915 CAGGAGTACCAGCAGGAATGGGG + Intronic
1173176646 20:40769954-40769976 CAGTAGTCCCAGAAGGGGTGAGG - Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173750517 20:45471623-45471645 GAGGAGGACCAGAAGGAGAGAGG + Intronic
1173986131 20:47262948-47262970 ACCCAGTACCAGATGGAGTGAGG + Intronic
1174760652 20:53203651-53203673 CAAGGGTGCCAGGTGGAGTGTGG + Intronic
1175344197 20:58259800-58259822 CAGGTGTGGCAGATGGAGAGGGG - Intergenic
1175780128 20:61676897-61676919 CTGGAGGACCTGATGGGGTGAGG + Intronic
1176161734 20:63652074-63652096 CAGGACTCCCAGATAGGGTGGGG + Intronic
1176963611 21:15187636-15187658 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1178348494 21:31852373-31852395 AAGGTGTATCAGATGGAGGGTGG - Intergenic
1181639837 22:24190648-24190670 CAGGGGTTCCAGATGGACAGGGG + Intergenic
1182298180 22:29322545-29322567 CATGAGTACCACGTGGAATGTGG + Intergenic
1182549142 22:31091628-31091650 CAGGAGGATCAGGTGGAGTGAGG - Intronic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1183827042 22:40396738-40396760 CAGGAGGACCAGAGTGAATGGGG + Intronic
1184379328 22:44135180-44135202 CAGGAGCTCCAGATGGAGCCTGG - Intronic
1184664550 22:45981205-45981227 CAGAAGAACCCCATGGAGTGTGG - Intergenic
949949564 3:9217912-9217934 CAGGAGAGCCAGATGCAGTGGGG - Intronic
950500753 3:13362034-13362056 GAGGAGCACCAGGTGAAGTGGGG - Intronic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
953342194 3:42144105-42144127 CAGGAGTGACAGGTGGGGTGAGG - Intronic
953543353 3:43841896-43841918 CAGGAGGAGCAGAGGGAGTGGGG + Intergenic
953551816 3:43908945-43908967 CAGGAGCACCAAGTGGCGTGAGG + Intergenic
953938735 3:47071204-47071226 AAAAAGTATCAGATGGAGTGTGG - Intronic
953974976 3:47375590-47375612 GAGGGGTTGCAGATGGAGTGGGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
955111771 3:55957706-55957728 CAGGTGTTCCAGCTGCAGTGGGG + Intronic
956166881 3:66403939-66403961 CAGAAGTACCAAGTGGGGTGGGG - Intronic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
961306500 3:125961420-125961442 CAGGAGGGCCTGAGGGAGTGGGG - Intergenic
964813734 3:160694358-160694380 AAGGAATAGGAGATGGAGTGAGG + Intergenic
966614661 3:181900340-181900362 CAGGAGGACCAGACAGATTGGGG + Intergenic
967224158 3:187275063-187275085 CTGGAGTCCCAGAAGGGGTGAGG - Intronic
967976987 3:195040992-195041014 AAGGAGTTCCTGATGGAATGAGG + Intergenic
968552364 4:1230148-1230170 CTGGTGCACCAGATGCAGTGTGG + Intronic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969552983 4:7884112-7884134 CAGGAGCAAGAGAGGGAGTGGGG - Intronic
970682942 4:18532487-18532509 CAGAAGTAGAAAATGGAGTGAGG - Intergenic
971526759 4:27629489-27629511 AAGGAGTACCAGAATAAGTGGGG - Intergenic
973826670 4:54714443-54714465 AAGAAATACTAGATGGAGTGGGG - Intronic
974255608 4:59450531-59450553 CAGGAGTTCCATATGTAGTTGGG + Intergenic
974887360 4:67836163-67836185 AAGTAGTACCAAAAGGAGTGAGG - Intronic
975329451 4:73098257-73098279 CAGCAGTACCAGCGAGAGTGGGG - Exonic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
978206325 4:106084462-106084484 CCGGAGTACCAGAAGGAGACAGG + Intronic
980458409 4:133074165-133074187 CAGGAGTACTAGAGAGAGCGGGG - Intergenic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982567001 4:156998038-156998060 CAGGAGCACGAGAAAGAGTGAGG + Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
987026997 5:13937459-13937481 CAGGAGTAGAAGATGGGGTGAGG - Intronic
987950599 5:24670076-24670098 CAGAAGTCCTACATGGAGTGGGG - Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988669911 5:33370389-33370411 GGGGAGTGGCAGATGGAGTGGGG + Intergenic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
993962456 5:94316613-94316635 CAGGACAGCCAGATGGGGTGAGG - Intronic
995359556 5:111279472-111279494 CAGATGTGCCAGAGGGAGTGGGG + Intronic
998070070 5:139190905-139190927 CATGAGTATGAGATGGGGTGTGG + Intronic
998093477 5:139384088-139384110 CAGGAGCATTAGATGGAGCGTGG + Intronic
1000082798 5:157863486-157863508 TAGTAGAACCACATGGAGTGGGG + Intergenic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1003460256 6:6322050-6322072 GAGGAGTAACAGCAGGAGTGGGG - Intergenic
1004515552 6:16319429-16319451 CAGGAGTTTCAGGTGGGGTGTGG + Intronic
1007143072 6:39596147-39596169 CAGGTCAACCAGATGGAGTTTGG + Exonic
1007784522 6:44272067-44272089 CAGGAGTACCCAGTGTAGTGGGG + Intronic
1007842711 6:44729986-44730008 TTTGAGTACTAGATGGAGTGGGG - Intergenic
1008522318 6:52374034-52374056 CAGGAGTAAGAGAGGGAGTGGGG - Intronic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1012955727 6:105567878-105567900 AAGGAATAGCAGATGGTGTGGGG - Intergenic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022048517 7:26643200-26643222 CAGCAGGAACAGACGGAGTGGGG - Intronic
1023699914 7:42882793-42882815 CAGGCATACCAGCTGCAGTGGGG + Intergenic
1023704004 7:42920268-42920290 CAAGAGTATCAGATGAAGGGAGG + Intronic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1027787445 7:82598276-82598298 CAGGTGCACCAGATAAAGTGAGG - Intergenic
1032412272 7:131704867-131704889 CAGGAATTCCATATGGTGTGGGG - Intergenic
1034413652 7:150954098-150954120 CAGCGGTACCAGATGGGCTGCGG + Intronic
1036091159 8:5667238-5667260 CAGGAGTGACAGATGAACTGTGG - Intergenic
1038834954 8:31109116-31109138 CAGAACTACCAGCTGTAGTGTGG + Intronic
1041018994 8:53619105-53619127 CAGGATTACCAGCTGTGGTGGGG - Intergenic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041728405 8:61039996-61040018 GAGGACTACTAGAAGGAGTGAGG - Intergenic
1042415316 8:68511402-68511424 CAGGGGTACTAGTTGGAGTGGGG + Intronic
1043180473 8:77082177-77082199 CAGGTGTGCCAGGTGCAGTGGGG + Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044952981 8:97451630-97451652 CAATGGCACCAGATGGAGTGAGG - Intergenic
1045280968 8:100749477-100749499 CATGAGTTCCAGCTGGGGTGAGG + Intergenic
1045332771 8:101170022-101170044 GAGGAGTACCATTTTGAGTGGGG + Intergenic
1045859797 8:106803274-106803296 AAGGAGTAGCAGAGGGACTGGGG - Intergenic
1047151739 8:122271756-122271778 CAAGTTTACCAGATGTAGTGAGG - Intergenic
1048156034 8:131952784-131952806 CAGGAGTAGCAGATGGACAATGG - Intronic
1048540371 8:135336152-135336174 GAGGAGTACCTGATCGTGTGAGG - Intergenic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1053243842 9:36518479-36518501 CAGGAGTTCCAGACCCAGTGTGG - Intergenic
1054744966 9:68844758-68844780 CAGGAGTACCAGCTGGGTAGAGG - Intronic
1055558183 9:77496980-77497002 GAGGAATACGAGATGGAGGGTGG - Intronic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057987051 9:99727764-99727786 AAGGAGTAAAAGATGGAATGGGG - Intergenic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058474463 9:105317721-105317743 CAGGAGTACAAGATAGAGTCAGG - Intronic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059507265 9:114810967-114810989 CAAGAGAACCAGATGGGGGGAGG - Intergenic
1059736338 9:117103619-117103641 CAAGAGCAGGAGATGGAGTGTGG - Intronic
1062446731 9:136598371-136598393 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446759 9:136598469-136598491 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446773 9:136598518-136598540 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446806 9:136598641-136598663 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1190587792 X:51964740-51964762 GAGGAGTACCTGGTGGTGTGAGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1192466613 X:71361467-71361489 CAGGAGTTCAAGATTCAGTGTGG - Intergenic
1194890731 X:99374975-99374997 CAGGGATACTTGATGGAGTGAGG + Intergenic
1198375045 X:136030526-136030548 CAGGAAGAGCAGCTGGAGTGGGG - Intronic
1199136409 X:144258716-144258738 GTGGAGTACTAGATGGAGTAGGG - Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199717273 X:150515637-150515659 CAGGAGTGCCAGGGGCAGTGAGG - Intergenic
1200065460 X:153502392-153502414 CAGGAGAGCAAGATGGAGTGGGG - Intronic