ID: 1139375098

View in Genome Browser
Species Human (GRCh38)
Location 16:66491947-66491969
Sequence CTCCGAGGAAAGATGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139375093_1139375098 17 Left 1139375093 16:66491907-66491929 CCTGGGGATTGGGGACTCCTGCA 0: 1
1: 4
2: 57
3: 377
4: 976
Right 1139375098 16:66491947-66491969 CTCCGAGGAAAGATGAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 106
1139375095_1139375098 0 Left 1139375095 16:66491924-66491946 CCTGCACTGGACTGTTACTGCCT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1139375098 16:66491947-66491969 CTCCGAGGAAAGATGAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 106
1139375092_1139375098 23 Left 1139375092 16:66491901-66491923 CCAAGGCCTGGGGATTGGGGACT 0: 1
1: 2
2: 26
3: 231
4: 695
Right 1139375098 16:66491947-66491969 CTCCGAGGAAAGATGAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139375098 Original CRISPR CTCCGAGGAAAGATGAACCA AGG Intronic
901535738 1:9882043-9882065 CCCTGAGGAAAGAAGACCCAGGG + Intronic
905202486 1:36323632-36323654 CTCCGAGGAAAGAGGAGGGACGG + Intronic
907951020 1:59184306-59184328 CTGCAAGGAAAGATGAAAAATGG - Intergenic
912077347 1:105891860-105891882 CTCTTAGGAAGGATGAACCAGGG + Intergenic
918460254 1:184769106-184769128 CTCCGAGGTAACATAATCCAGGG - Intergenic
920403643 1:205693224-205693246 CTCCTAAGGAAGATGACCCAAGG + Intergenic
922496751 1:226063068-226063090 CACCGAAGAAAGAGGAGCCAGGG - Intronic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1067936494 10:50616591-50616613 GTTTGAGGAAAGAGGAACCAGGG + Intronic
1068216217 10:53985637-53985659 CCCCGAGAAAAGATCAAGCAGGG + Intronic
1074280689 10:112048772-112048794 CTCCAAGGCAAGATGAATCATGG + Intergenic
1075816281 10:125266975-125266997 CTCAGTGGAAGGATGAACCCAGG - Intergenic
1079973610 11:27065321-27065343 CACAGAGGAAAAATGAAGCAAGG - Intronic
1083167564 11:60900538-60900560 AGCCAAGGAAAGAAGAACCAAGG + Intronic
1083347944 11:62006570-62006592 CTCCAAAGAAAAAGGAACCAAGG + Intergenic
1084221200 11:67680759-67680781 CTCCAAGGAAAGCAGAATCATGG + Intronic
1086453794 11:86942220-86942242 TTCCCAGGAAAGATGACCCAAGG + Intronic
1088311299 11:108463534-108463556 CTCTGAGGCAAGATAGACCAGGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089002830 11:115066647-115066669 CTCCAAGAAAAGCTGAACCTTGG - Intergenic
1092206237 12:6615794-6615816 CTTTGAGGAAGGGTGAACCAAGG + Intergenic
1093601894 12:21036800-21036822 CTCCCAGGAAAGAAAAGCCAAGG - Intronic
1095336258 12:41031076-41031098 CGGTGAGGAATGATGAACCAAGG - Intronic
1100943271 12:99748701-99748723 CTCTGAAGAAAGATAAAACAGGG + Intronic
1105319546 13:19305372-19305394 GTCCTCTGAAAGATGAACCATGG - Intergenic
1108003845 13:45928123-45928145 CTCTGAGGGAAGAAGAACAATGG - Intergenic
1108524284 13:51272652-51272674 CTCTCTGGAAAGATGGACCAGGG + Intronic
1116606730 14:47008217-47008239 CTCCGAGTAAATATGAAGAAGGG + Intronic
1117670624 14:58102267-58102289 GTCCCAGGAGAGAAGAACCATGG + Intronic
1118308107 14:64673078-64673100 CTCCCAGGAAAGGTGAGCCTTGG - Intergenic
1121138621 14:91521364-91521386 CTCTGAGGAAAGCTGAATCCAGG - Intergenic
1126197087 15:45944453-45944475 CTCAGAGGAGAGATTAACGATGG - Intergenic
1129137076 15:73563898-73563920 CACCGAGGAAAGCTGAACAGTGG + Intronic
1129367969 15:75068644-75068666 CGCCAGGGGAAGATGAACCAGGG + Intronic
1133805702 16:9124644-9124666 CTACGAGGGAAGCTGGACCAAGG + Intergenic
1134845302 16:17435017-17435039 CAGCTAGGAAAGATGAACTAAGG - Intronic
1135945877 16:26864608-26864630 CTCAGAGGAAAGCAGATCCAGGG + Intergenic
1138157907 16:54722794-54722816 CTCCCAGGTAAGGTGAAACAGGG + Intergenic
1139375098 16:66491947-66491969 CTCCGAGGAAAGATGAACCAAGG + Intronic
1148887718 17:50785827-50785849 GTCCTAGGCAGGATGAACCAAGG + Intergenic
1150230122 17:63545191-63545213 CTCCGAGGCTATAGGAACCAAGG - Exonic
1150303443 17:64064819-64064841 CCCCGGGGAAAGATGAACATGGG + Intronic
1151849435 17:76681687-76681709 CTCAGAGGGAAAATGAACCCAGG - Intronic
1154320059 18:13342360-13342382 CTCCTATGAAAGAAAAACCAAGG - Intronic
1158239164 18:55357752-55357774 CTCCCTGGAAACAGGAACCAGGG + Intronic
1161848111 19:6723959-6723981 CTCAGAGAAAAGAGGAACCCAGG - Intronic
1167307802 19:48719241-48719263 CTCCGAGGAAGGAGGAAGCTGGG + Intronic
925623596 2:5819448-5819470 CTCTGAGGAAAGCTCACCCAAGG - Intergenic
932027697 2:68152431-68152453 GTCTGAGGAAAGAGGAAACATGG - Intronic
934910726 2:98251917-98251939 CTGAGAGGAAAGAAGAACCAAGG + Intronic
935309797 2:101772238-101772260 CTTCCAGGAAATAAGAACCAAGG - Intronic
935568764 2:104636948-104636970 CTCCGAGGCAAGAGGCACCAAGG + Intergenic
937350715 2:121159143-121159165 CTCTGAGGAATGATGAGGCAAGG - Intergenic
937501094 2:122480206-122480228 TTCGGAAGAAAGATGAACTAAGG - Intergenic
938029047 2:127976209-127976231 GGCAGAGGAAAGAGGAACCAAGG - Intronic
938750878 2:134328785-134328807 CTCTGAGGAAAAATAAACTAGGG + Intronic
941095625 2:161237695-161237717 CTCCGGGGAAAGCTGCACCGGGG - Intergenic
946891538 2:224282220-224282242 CTAGGAGGTAAGATGTACCATGG - Intergenic
947546593 2:231014927-231014949 TTCAGAGCAAAGATGATCCAGGG + Intronic
1170633310 20:18083471-18083493 CGCCGAGGTAAGAAGAAACACGG - Intergenic
1171286038 20:23938673-23938695 CTCAGTGGAAAGGAGAACCATGG - Intergenic
1173554282 20:43954533-43954555 CTCTGCGGAAAGATGAAGGATGG + Intronic
1180727427 22:17956681-17956703 CTCCGAGAAAAGAAGAGCAAAGG + Intronic
1181907391 22:26210142-26210164 CTCTCAGTAGAGATGAACCATGG + Intronic
1182560148 22:31153286-31153308 TTCCTAGCAAAGATGAAGCATGG - Intergenic
1182821483 22:33220601-33220623 CTCAGAGGAGAGAAGAAACAGGG - Intronic
952997939 3:38903443-38903465 CTCCCTGGAAAGATGAATCAGGG - Intronic
953874727 3:46660165-46660187 CTCTGAGGAAAGATGACCTTGGG - Intergenic
954940678 3:54369516-54369538 GTCAGAGGAAAGGTGATCCAGGG - Intronic
958703373 3:97621573-97621595 CTAAGAAGAAAGTTGAACCAGGG + Intronic
959156710 3:102675113-102675135 TTCCAAGGCAAGAAGAACCAGGG - Intergenic
962020945 3:131501553-131501575 GTCCTCTGAAAGATGAACCATGG - Exonic
962350008 3:134649834-134649856 CTCTGGGGACAGAAGAACCAAGG + Intronic
962411966 3:135148950-135148972 CTCCAAGGAAAAATCAACTAGGG - Intronic
963225955 3:142861937-142861959 CTCCGATGAAAGCTGCAGCAAGG - Intronic
964249139 3:154690428-154690450 CTCTGAGCAAAGATCAACCCAGG + Intergenic
970471369 4:16382484-16382506 CTCAGAAAAAAGAAGAACCAGGG + Intergenic
975668814 4:76759715-76759737 TTCTGAGGAAAGCTGAACAAGGG - Intronic
976972353 4:91120524-91120546 CTCAGAGGAAAGCTAAAACATGG + Intronic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
981453512 4:144927080-144927102 CTCCCAGCAAAGAAAAACCAGGG - Intergenic
983472216 4:168171458-168171480 ATCAAAGGAAAGATGACCCATGG + Intronic
983553793 4:169042009-169042031 AGTGGAGGAAAGATGAACCAAGG - Intergenic
986349234 5:6861998-6862020 CTCCTAAGAAAAATAAACCAGGG + Intergenic
1001275060 5:170344742-170344764 CTCTGAGGAAAGATAAACCGGGG + Intergenic
1004758253 6:18637370-18637392 CTTGCAGGAAAGAGGAACCAGGG - Intergenic
1006362963 6:33597505-33597527 ATCTGAGGAAAGATAAAGCAGGG - Intergenic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1007080130 6:39094634-39094656 CTCCCAGGAGATATGCACCATGG - Intergenic
1007207916 6:40167560-40167582 CTCCTAGGAAAGATGAGAGAGGG - Intergenic
1015565637 6:134567680-134567702 CCCAGTGGAAAGAGGAACCAAGG - Intergenic
1016792976 6:148085863-148085885 CCCAGAGGAAAGATGATCCTAGG + Intergenic
1018845023 6:167549750-167549772 ATCTGAGCAAAGATTAACCACGG - Intergenic
1021205358 7:17773516-17773538 CTCCCAGGATGGATGAACAAGGG - Intergenic
1021538702 7:21733080-21733102 CTCCCAGCAAAGAAGAAGCAGGG + Intronic
1029639393 7:101809812-101809834 CTCCTGGGAGATATGAACCATGG - Intergenic
1033544446 7:142387268-142387290 CTCTGAGGATAGATGAAGGAAGG + Intergenic
1038670695 8:29580728-29580750 CTCAAAGGAAAGATGGTCCATGG - Intergenic
1040857305 8:51961387-51961409 CTCAGAGGAAAGGTGAGCCAAGG + Intergenic
1042207613 8:66344984-66345006 CTCCAAGGCAAAATGAACCAAGG + Intergenic
1043009427 8:74863253-74863275 CTATGAGGAAAAATGAAACAGGG + Intergenic
1044562711 8:93628579-93628601 CTCGGAGGAAAATTGAACAATGG - Intergenic
1047517390 8:125567044-125567066 TTCCTAGGAAAGTTGAACAATGG + Intergenic
1048333587 8:133487385-133487407 CTCAGAGGAATGATGATCCTGGG - Intronic
1048750425 8:137667378-137667400 CTCTTATGAAAGATGAATCAAGG + Intergenic
1050862838 9:10458067-10458089 CTCCCAGGAAAGAAAAACCCAGG + Intronic
1052549279 9:29927412-29927434 CTCAGAATAAAGATAAACCATGG - Intergenic
1054730779 9:68700974-68700996 CTGAGAGGAAAGAGGAACAAGGG + Intergenic
1055593951 9:77846713-77846735 CTCTGAGGGAGGATTAACCAAGG - Intronic
1056411268 9:86329948-86329970 CTCTGAGGAAAAATAAACCAGGG - Intronic
1059476202 9:114549886-114549908 CACAGAGGAAAGCAGAACCAGGG + Intergenic
1059925144 9:119202045-119202067 CTCCGAGACAAGATGATCCAAGG - Intronic
1185753944 X:2637833-2637855 CTCCCAGGAAAAATAAATCATGG + Intergenic
1189842075 X:45090792-45090814 ATTCCAGGAAAGATGAACCATGG - Exonic
1196206751 X:112948504-112948526 CTCAGTGGAGAGATGGACCAAGG + Intergenic
1196553998 X:117065186-117065208 CTTCATGGAAAGCTGAACCAGGG - Intergenic
1199623003 X:149715702-149715724 CTCAGATGAGATATGAACCATGG - Intronic
1199706215 X:150427755-150427777 ATCAGAGGAAAAATGAACTAAGG - Intronic
1201374135 Y:13297757-13297779 ATTCCAGGAAAGATGCACCATGG + Exonic