ID: 1139376628

View in Genome Browser
Species Human (GRCh38)
Location 16:66502767-66502789
Sequence TACTGTGGAAGGAGGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1345
Summary {0: 1, 1: 0, 2: 9, 3: 84, 4: 1251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139376628_1139376640 16 Left 1139376628 16:66502767-66502789 CCTTCCCCCCTCCTTCCACAGTA 0: 1
1: 0
2: 9
3: 84
4: 1251
Right 1139376640 16:66502806-66502828 TCTCTCACTCACGTCCCTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1139376628_1139376638 13 Left 1139376628 16:66502767-66502789 CCTTCCCCCCTCCTTCCACAGTA 0: 1
1: 0
2: 9
3: 84
4: 1251
Right 1139376638 16:66502803-66502825 TCCTCTCTCACTCACGTCCCTGG 0: 1
1: 0
2: 0
3: 23
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139376628 Original CRISPR TACTGTGGAAGGAGGGGGGA AGG (reversed) Intronic
900496870 1:2979717-2979739 TTCTCAGGAAGGAGGCGGGAAGG - Intergenic
900706934 1:4086836-4086858 AAATGTGGGAGGAGGCGGGAGGG + Intergenic
900987553 1:6082031-6082053 TCCTGTGGCAGGAGAGGGCAAGG + Intronic
901060500 1:6469678-6469700 TGCAGTGGCAGGAGGGGGGGTGG + Intronic
901703385 1:11057264-11057286 TGGTCTGGAAGGAGGGGGTAGGG - Intronic
902034836 1:13449958-13449980 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
902069003 1:13716300-13716322 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
902131676 1:14267028-14267050 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
902275862 1:15338767-15338789 GACTGCTGAAGGAGAGGGGAGGG - Intronic
902513409 1:16978020-16978042 TGCTGTGGAAGGCTGGGGGAAGG + Intronic
902562195 1:17284522-17284544 CACTGTGGAAGGATGGGCAATGG + Intergenic
903190596 1:21653599-21653621 TACTTAGGAAGGAGGGAGGGAGG - Intronic
903190609 1:21653651-21653673 TACTTAGGAAGGAGGGAGGGAGG - Intronic
903270898 1:22187633-22187655 CACCGTGGAAGGATGCGGGATGG - Intergenic
903391450 1:22966431-22966453 TACTGAGGACAGAGGAGGGAAGG - Intergenic
903489536 1:23717709-23717731 TACAGTGGAGGAAGTGGGGAGGG + Intergenic
903506727 1:23841266-23841288 TTCTGTGGCAGTAGAGGGGATGG + Intergenic
903531375 1:24032861-24032883 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
904619392 1:31766294-31766316 TCCTGGGGAAGGAGGAGGGGGGG - Intergenic
905449493 1:38047281-38047303 TACTGAGGAGGGAGGGGCGCGGG - Intergenic
905908468 1:41637443-41637465 GACTGTTGAGGGAGGGGGGCAGG - Intronic
906195326 1:43926913-43926935 GCCTGTGGAAGGTGGGGGGCAGG - Intronic
906236946 1:44217773-44217795 GTCTGTGGAAGAAGGGAGGAAGG + Intronic
906363657 1:45186251-45186273 TGCAGTGGGGGGAGGGGGGAGGG + Intronic
906581105 1:46935646-46935668 TCCTGTGGTGGGAGGGGGCATGG + Exonic
906599756 1:47115296-47115318 TGGGGTGGAGGGAGGGGGGATGG + Intronic
906602619 1:47143248-47143270 TCCTGTGGTGGGAGGGGGCATGG - Exonic
907487217 1:54786488-54786510 TACTTTGTAAGGTTGGGGGATGG - Intronic
907572057 1:55492479-55492501 TGCTGGGGAAGGAAGGTGGAAGG + Intergenic
908018206 1:59869638-59869660 TACTATGGATGTAGGGAGGAGGG - Intronic
908330310 1:63064479-63064501 AACTCTGGAGGGAGGGGGAATGG - Intergenic
908637524 1:66184980-66185002 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
908692264 1:66795842-66795864 TGAGGTGGAGGGAGGGGGGAGGG - Intergenic
908725900 1:67176776-67176798 TGTGGTGGGAGGAGGGGGGAGGG - Intronic
908741865 1:67337082-67337104 TACTGCAGGAGGAGGGGAGATGG + Intronic
908840699 1:68277296-68277318 TGGGGTGGAAGGAGGTGGGATGG + Intergenic
908978165 1:69922958-69922980 TGGGGTGGCAGGAGGGGGGAGGG - Intronic
909248907 1:73327207-73327229 TACTGTGGTGGGTGGGGGGAGGG + Intergenic
909297772 1:73972625-73972647 TAATGGGGCAGGATGGGGGATGG + Intergenic
909516349 1:76511479-76511501 CACTGTGGGAGGAAAGGGGAGGG - Intronic
909571121 1:77111607-77111629 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
910060965 1:83091283-83091305 TACTATTGAAGGAAGGTGGATGG + Intergenic
910312006 1:85834600-85834622 TGCTGTGGGCGGAGGGGGGCTGG - Intronic
910324880 1:85995574-85995596 CCCTGAGGAGGGAGGGGGGAAGG + Intronic
910386340 1:86687038-86687060 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
910884793 1:91953092-91953114 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
911049228 1:93655380-93655402 GAGTGTGGGAGGTGGGGGGATGG + Intronic
911070103 1:93825635-93825657 CCCTGGGGAAGGAGGGTGGAAGG - Intronic
911090630 1:94014321-94014343 GACGGGGGAAGGAGGGAGGAGGG + Intronic
911207961 1:95111694-95111716 GACTGTGGAAGGCAGGGGCAGGG + Intergenic
911219268 1:95230027-95230049 TATAGTGGAAGGAGGGAAGAAGG - Intronic
911390336 1:97233354-97233376 TACTGCAGAAGGGGGGAGGACGG + Intronic
911881960 1:103251233-103251255 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
911900097 1:103492756-103492778 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912739243 1:112178208-112178230 TGCTGTGAAAGGTGGGGGCAGGG - Intergenic
913360348 1:117973823-117973845 GACTCTGAAAGGAGGGAGGAAGG - Intronic
913641895 1:120820296-120820318 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
914418348 1:147505246-147505268 TTCTGTGGGAGGATGGGGGAGGG - Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915142177 1:153774752-153774774 AACTGGGGAAGGAGAGAGGAAGG - Intronic
915205000 1:154263556-154263578 TGCTGTGGATGAAGGGTGGAGGG + Intronic
915253671 1:154608820-154608842 CAATGTGGAGGGGGGGGGGAGGG + Intronic
915594249 1:156887387-156887409 TTCTTTGGAAGCAGGGAGGAAGG + Intergenic
915861082 1:159445024-159445046 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
916154881 1:161834625-161834647 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916595631 1:166240114-166240136 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
916660964 1:166921826-166921848 TACTGGGGCAGGAGGGGAGAAGG + Intronic
916720830 1:167483856-167483878 TGCTGGGGAGGGAGTGGGGAGGG - Intronic
916812462 1:168317558-168317580 TACTTTGGCAGGAAGGGGGCTGG - Intergenic
917304446 1:173612603-173612625 GACTGTGGAAGGAGAGGGAGAGG - Intronic
917331064 1:173881095-173881117 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
917372196 1:174305906-174305928 TAGGGTGGGAGGAGGGGGGAGGG - Intronic
917394719 1:174580630-174580652 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
917987875 1:180339531-180339553 TAGGGTGGAAGGAGGGAGGGAGG + Intronic
918397525 1:184130712-184130734 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
918848430 1:189650053-189650075 TGCGGTGGTGGGAGGGGGGAGGG + Intergenic
919250071 1:195043318-195043340 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
919322246 1:196058073-196058095 AACTTTGGAAGGAGGGGGCGTGG + Intergenic
919522973 1:198612186-198612208 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
919625837 1:199909479-199909501 ATCTGTGGAACGAGGGGTGATGG - Intergenic
919736293 1:200953886-200953908 TAATGTGGTAGGAGGGGAGAAGG - Intergenic
919926062 1:202192469-202192491 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
920184230 1:204150646-204150668 AACTGAGGCAGGAGAGGGGAGGG + Intronic
920452914 1:206073731-206073753 TACTTTGAATGGAGGTGGGAAGG - Intronic
920522967 1:206642775-206642797 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
920781648 1:208997419-208997441 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
921403258 1:214749927-214749949 TTCGGTGGGGGGAGGGGGGAGGG + Intergenic
921446029 1:215248464-215248486 CCCTGTGAAAGGAGGGAGGAAGG + Intergenic
922707219 1:227795826-227795848 TCCTGAGGAAGGAGGGGGTTGGG - Intergenic
922848727 1:228712660-228712682 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
922994306 1:229943903-229943925 AGCTGTGGGAGGAGGAGGGAAGG + Intergenic
923870550 1:237988786-237988808 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
923889621 1:238198458-238198480 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
924041458 1:239988285-239988307 TACTGCTGAGGGAGGGAGGAAGG + Intergenic
924649610 1:245913362-245913384 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
924701336 1:246456573-246456595 TACTGTGGAAGCTAGGTGGAAGG - Intronic
1063015644 10:2074523-2074545 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1063311837 10:4960063-4960085 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1063362406 10:5469176-5469198 GACAGAGGAAGGAGGAGGGAGGG - Intergenic
1063688234 10:8258737-8258759 TCCTGTGGAAGAAGGGAGAATGG + Intergenic
1063744773 10:8868392-8868414 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1063753328 10:8977016-8977038 GGATGTGGAAGGAGGGGGGGGGG + Intergenic
1063793676 10:9485352-9485374 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1064300346 10:14117661-14117683 GAAGGTGGAAGGAGGGTGGAAGG + Intronic
1064350142 10:14568714-14568736 TACTGGGGAAGGAGGCAGCATGG + Intronic
1064514096 10:16127330-16127352 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1064561822 10:16601193-16601215 ACCTGTGGAAGGTGGGGTGAGGG - Intronic
1064841886 10:19602336-19602358 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
1064845322 10:19645728-19645750 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1064892360 10:20191656-20191678 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1064919001 10:20495769-20495791 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1065209275 10:23387525-23387547 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1065237308 10:23666558-23666580 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1065255828 10:23866990-23867012 TGCGGTGGGGGGAGGGGGGAGGG - Intronic
1066260478 10:33724955-33724977 TTCTGAGGCAGGAGGGAGGAGGG - Intergenic
1066396324 10:35026975-35026997 TAGTCTGGGAGGAGGGGGGAGGG - Intronic
1066664756 10:37771624-37771646 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1067152518 10:43748590-43748612 TACAGTGAAAGGAGGAGGGGAGG + Intergenic
1067160486 10:43821213-43821235 TGCTGTGGAGGGAGGGGACAGGG - Intergenic
1067744736 10:48927227-48927249 GTGTGTGGAAGCAGGGGGGAGGG - Intronic
1067744769 10:48927362-48927384 TATTGTGGGTGGTGGGGGGAGGG + Intronic
1068277789 10:54825014-54825036 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1068280321 10:54860292-54860314 TAGAGTGGGAGGAGGGGGAAGGG - Intronic
1069110090 10:64436492-64436514 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1069278244 10:66619562-66619584 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1069322015 10:67183539-67183561 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1069650894 10:70047427-70047449 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1070710290 10:78676634-78676656 TGGGGTGGCAGGAGGGGGGAGGG - Intergenic
1070796759 10:79221450-79221472 TACTGAGGAGGGAGGGGGCCTGG - Intronic
1071413293 10:85417843-85417865 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071458636 10:85870636-85870658 TGCTGTGGAAGGAAGGTGGAGGG + Intronic
1071740252 10:88350372-88350394 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1072571909 10:96665759-96665781 TACTGAGGAAAGAAGGGGGCAGG + Intronic
1072706743 10:97686663-97686685 GATTGTGGAAGGAGCAGGGAGGG + Intronic
1073031402 10:100529227-100529249 CTCTGTGGAGGGAGGTGGGAGGG - Intronic
1073996552 10:109322503-109322525 TACTGTTGGAGGGGGTGGGACGG + Intergenic
1074152312 10:110768213-110768235 GACCGTGGAAAGAGGGGAGAGGG + Intronic
1074179795 10:111049115-111049137 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1074232718 10:111553836-111553858 GACTGAGGGAGGAGGGGGAAGGG - Intergenic
1074498367 10:113999875-113999897 TGCTGTGGAAGAAAAGGGGAAGG - Intergenic
1074550021 10:114434039-114434061 TACTCTGGAAAGTGTGGGGATGG - Intronic
1074661375 10:115661919-115661941 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1075005225 10:118825428-118825450 TAGGGTGGAAGCAGGGGTGAGGG - Intergenic
1075063905 10:119276258-119276280 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1075118712 10:119648836-119648858 TACTTTCGAATGAGGGGTGAGGG + Intergenic
1075252498 10:120893155-120893177 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075491353 10:122872786-122872808 TGGGGTGGGAGGAGGGGGGACGG + Intronic
1075762929 10:124870363-124870385 CTCTGTGCAAGGAGCGGGGAAGG + Intergenic
1075780980 10:125016954-125016976 CACTGTGGATGGAAGGGGAATGG + Intronic
1075970166 10:126645111-126645133 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1076199319 10:128545894-128545916 TACAGTGTAAGGAGTGGGGAGGG - Intergenic
1076257791 10:129042278-129042300 TACCGTGGATGGAGTAGGGAAGG - Intergenic
1076486133 10:130818939-130818961 GGCTGTGGAAGGTGGGAGGACGG - Intergenic
1077498427 11:2897849-2897871 TGATCTGGAAGGAGCGGGGAGGG - Intronic
1077498458 11:2897986-2898008 TGATGTGGAGGGAGCGGGGAGGG - Intronic
1077528444 11:3083420-3083442 TACTGGGGAAGGGATGGGGAGGG - Intergenic
1077731176 11:4731553-4731575 CAGTGTGGAAGGAGAGGGTAAGG - Intronic
1077862120 11:6191213-6191235 TAGGGTGGGAGGAGGGGGGAGGG + Intergenic
1077867952 11:6238865-6238887 TGCTGTGGAAAGAGGGGAGGAGG + Intronic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1077931029 11:6732969-6732991 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1078124602 11:8548012-8548034 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1078951392 11:16138691-16138713 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1079693280 11:23446428-23446450 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1079804762 11:24916475-24916497 TGGGGTGGCAGGAGGGGGGAGGG - Intronic
1079839670 11:25381302-25381324 TAGGGTGGGAGGAGGGGGGAGGG - Intergenic
1079841072 11:25399775-25399797 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1080096865 11:28418713-28418735 CACTGCAGAAGGATGGGGGAGGG - Intergenic
1080375427 11:31704487-31704509 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1080796761 11:35571306-35571328 TACTAGGGAAGGAGGAGGAACGG + Intergenic
1081069291 11:38589985-38590007 TAGAGTGGGGGGAGGGGGGAGGG + Intergenic
1081162064 11:39761025-39761047 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1081216038 11:40399533-40399555 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1081347350 11:42006586-42006608 GACTGAGGATGGAGGTGGGAGGG - Intergenic
1081423253 11:42897416-42897438 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1081438202 11:43051617-43051639 TACTGAGCAGGGAGAGGGGAGGG + Intergenic
1081493390 11:43583521-43583543 TATTGTGAAGGGAAGGGGGAAGG - Intronic
1081681578 11:45009439-45009461 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1081697178 11:45122481-45122503 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1081886841 11:46505347-46505369 TACTGTAGAGGGAGGTGGGCAGG + Intronic
1081960236 11:47130667-47130689 TACTCTGTGAGGAGGGGGAAGGG - Intronic
1082248172 11:49949078-49949100 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082648597 11:55759065-55759087 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1082728075 11:56760620-56760642 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1082820025 11:57538427-57538449 TCCTGGGGAAGGAAGGAGGAAGG + Intergenic
1083343196 11:61972135-61972157 CACTGTGGAGGGAGGGAGGGAGG + Intergenic
1083406137 11:62458563-62458585 TACTTTGGAGGGTGGGAGGAGGG + Intronic
1083525398 11:63360438-63360460 TGCAGTGGAGGGATGGGGGAGGG - Intronic
1083972790 11:66091662-66091684 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1084027943 11:66464515-66464537 TAGGGTGGGAGGAGGGGGGAGGG + Intronic
1084738561 11:71122497-71122519 TAGTGTGGAGGGTTGGGGGAGGG + Intronic
1084780073 11:71402180-71402202 TGCTGAGGAAGGAGAGGTGAGGG + Intergenic
1084797352 11:71517038-71517060 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1085315314 11:75541288-75541310 TACTATGGAAGAAGGGGGCATGG - Intergenic
1085745603 11:79111813-79111835 TACAGAGAAAGGAGGTGGGAGGG + Intronic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1086483350 11:87269486-87269508 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1086549091 11:88033227-88033249 TGGCGTGGGAGGAGGGGGGAGGG + Intergenic
1086807109 11:91257375-91257397 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1086841642 11:91692713-91692735 CACTGAGGAAAAAGGGGGGAAGG + Intergenic
1087102191 11:94376358-94376380 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1087879236 11:103394985-103395007 AACTGTGGAAAGAGGAGGGTAGG - Intronic
1087942017 11:104109051-104109073 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1087982102 11:104628321-104628343 TAGTGTCGGGGGAGGGGGGAGGG - Intergenic
1088070554 11:105778926-105778948 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
1088428564 11:109731799-109731821 TAGGGTGGAGGGAGCGGGGAGGG + Intergenic
1088904240 11:114142278-114142300 TACTGGGGAAGGGGGTGGGAAGG - Intronic
1088933815 11:114378772-114378794 TACTATGGAAGGAGGGAAAAAGG - Intergenic
1088967618 11:114739450-114739472 TACTGAAGAAGGAGGGAGGGAGG - Intergenic
1089116456 11:116099167-116099189 TACTGGGGTAGGGGGGAGGATGG - Intergenic
1089213787 11:116823367-116823389 CACTGAGGAAGGAGGAGGGGAGG - Intergenic
1089418880 11:118316066-118316088 TACAGTGGAGGGGGGGTGGAGGG - Exonic
1090042227 11:123301297-123301319 TGTTGGGGAGGGAGGGGGGAGGG + Intergenic
1090625514 11:128604727-128604749 TCCAGTGAAAGGAGGTGGGAAGG - Intergenic
1091397538 12:163201-163223 TTCTGTGGAGGGGGAGGGGAGGG - Intronic
1091998466 12:5014085-5014107 TACTGGGGAGCGAGGAGGGAGGG - Intergenic
1092122840 12:6056748-6056770 TCCTGTGGAAAGAGGGCGTAGGG - Intronic
1092124012 12:6063296-6063318 TCCTGTGGCAGTAGGGGGAATGG - Intronic
1092159358 12:6307579-6307601 AAATGTGGAAGGAAGGGGGAGGG + Intergenic
1092326201 12:7534025-7534047 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1092705142 12:11274778-11274800 TGTGGTGGAGGGAGGGGGGAGGG + Intergenic
1092999640 12:13982125-13982147 TAAGGTGGATGGAAGGGGGACGG + Intergenic
1093322832 12:17735839-17735861 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1093462886 12:19422131-19422153 GACTCTGGGTGGAGGGGGGAGGG + Intronic
1093614699 12:21209199-21209221 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1093822256 12:23635523-23635545 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1093879627 12:24389097-24389119 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1094178735 12:27568493-27568515 AACTGTGTAAGGATGAGGGATGG + Intronic
1094860796 12:34464188-34464210 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1094872988 12:34608648-34608670 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1095515902 12:43005130-43005152 AACAGAGGAAGAAGGGGGGAGGG - Intergenic
1096146851 12:49284369-49284391 TACTGAGGAAGGAAAGGGCAGGG - Intergenic
1096842899 12:54390257-54390279 TATTGTGGAGGCAGGGTGGAGGG + Intronic
1096959735 12:55566344-55566366 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1097186880 12:57200832-57200854 TGCTGGGGAAGGAGGGAGGGTGG - Intronic
1097224922 12:57471463-57471485 TACTGTGGGAGGGTGGGGGCAGG + Exonic
1097246810 12:57611584-57611606 TCCAGTGGAAGGGGGAGGGATGG - Intronic
1097301497 12:58023723-58023745 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1097576691 12:61402325-61402347 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1098260755 12:68668038-68668060 CAGAGTGGAAGGATGGGGGAGGG - Exonic
1098261529 12:68676630-68676652 TCCTGAGGAAGGGGAGGGGAGGG + Intergenic
1098325160 12:69294229-69294251 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1098792363 12:74840122-74840144 AATTGTGGGGGGAGGGGGGAGGG + Intergenic
1098798616 12:74924106-74924128 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1098863127 12:75732199-75732221 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1099026197 12:77467638-77467660 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1099110004 12:78546857-78546879 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1099409501 12:82306957-82306979 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1099583815 12:84489932-84489954 TATGGTGGGGGGAGGGGGGAGGG - Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100741912 12:97603356-97603378 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1101702800 12:107191041-107191063 TGGAGTGGGAGGAGGGGGGAGGG + Intergenic
1102071524 12:110023853-110023875 AACTGTGGGAGGAGGGTGGAGGG + Intronic
1103081924 12:118031074-118031096 ATCTGTTGAAGGAGTGGGGATGG - Intronic
1103280804 12:119756561-119756583 AATGGTGGAAGGTGGGGGGAGGG + Intronic
1103767201 12:123288896-123288918 TGCTGCGGAAGGCGGTGGGAGGG - Intergenic
1104490206 12:129187352-129187374 TACAGGGGGAGGAGGAGGGATGG + Intronic
1104564310 12:129866443-129866465 TGCGGTGGGGGGAGGGGGGAGGG + Intronic
1104707460 12:130958173-130958195 TAGGATGGAGGGAGGGGGGAGGG - Intronic
1105348368 13:19594552-19594574 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1105663112 13:22521656-22521678 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1105673977 13:22650445-22650467 GACGGTGGATGGAGGAGGGAGGG - Intergenic
1105816035 13:24037203-24037225 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1106302816 13:28484931-28484953 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1106347963 13:28897900-28897922 TGAGGTGGAGGGAGGGGGGAGGG + Intronic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1106481208 13:30138298-30138320 TTCTGTGGAGAGAGGAGGGAGGG + Intergenic
1106568236 13:30905560-30905582 TACTGGGGAGGCAGGGGAGAAGG + Intergenic
1106738916 13:32618039-32618061 TATGGTGGAAGGAAGGCGGAAGG + Intronic
1107145453 13:37056615-37056637 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1107191254 13:37589489-37589511 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1107269483 13:38598408-38598430 GTCTGTGGAAGGAGGAAGGAAGG + Intergenic
1107492938 13:40899761-40899783 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1107628788 13:42320513-42320535 GACAGTGGGAGGAGGGGGGAGGG - Exonic
1107665244 13:42681635-42681657 TACTGTGGAGGGAGAGTGGGAGG - Intergenic
1108008843 13:45981868-45981890 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1108391568 13:49952481-49952503 TAGAGTGGAAGGAGGGTGGGAGG + Intergenic
1108491646 13:50987916-50987938 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1108610349 13:52079312-52079334 GACCGTGGAAAGAGGGGAGAGGG - Intronic
1108713419 13:53056320-53056342 TACTGTGGAAGGGAGTGGGGTGG - Intergenic
1108987463 13:56611344-56611366 TGCGGTGGAGGGAGGGGGGAGGG - Intergenic
1109142354 13:58730343-58730365 TACTATGGAAGAAGGAGTGAAGG + Intergenic
1109670503 13:65600480-65600502 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1110020874 13:70469958-70469980 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1110359111 13:74605471-74605493 TGAGGTGGGAGGAGGGGGGAGGG - Intergenic
1110699677 13:78532035-78532057 TAGGGTGGAGGGACGGGGGAGGG + Intergenic
1110703768 13:78580580-78580602 TATGGTGGAAGGTGGAGGGAGGG - Intergenic
1110754914 13:79161509-79161531 TAGTATGGAGGGAGGGGGGAGGG + Intergenic
1111046413 13:82819765-82819787 TTCCTTGGATGGAGGGGGGATGG - Intergenic
1111278667 13:85988777-85988799 TTATGGGGAAGGAGTGGGGAAGG + Intergenic
1111353380 13:87063480-87063502 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1111694280 13:91604093-91604115 TGGTGTGGTGGGAGGGGGGAGGG - Intronic
1111844129 13:93488110-93488132 TGGGGTGAAAGGAGGGGGGAGGG - Intronic
1112083634 13:96004672-96004694 TACTTTGGGGGGAGGGGGGAGGG - Intronic
1112154234 13:96799631-96799653 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1112402246 13:99086840-99086862 CACTGGGGAAGGTGGGGGGTCGG + Intergenic
1112851042 13:103706966-103706988 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1113031709 13:106000471-106000493 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1113151666 13:107270805-107270827 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1113558279 13:111255806-111255828 TCCTGTGGAAGGTGGGGTCATGG + Intronic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114290077 14:21280716-21280738 AACTAGGGAAGGAGGGGGGTGGG - Intergenic
1114305637 14:21420350-21420372 TCTTGTGGAAGGAGGGGGAGGGG - Intronic
1114630366 14:24155536-24155558 TACTGTGGAGGGGCAGGGGATGG + Intronic
1114649875 14:24277752-24277774 GACTGTGGGAGGAGGGTGGAAGG + Intergenic
1114761127 14:25315882-25315904 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1114915977 14:27265611-27265633 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1114963085 14:27919609-27919631 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1114967097 14:27976098-27976120 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1114982295 14:28179797-28179819 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1115275365 14:31602239-31602261 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1115537462 14:34386482-34386504 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1116025779 14:39512517-39512539 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1117117438 14:52529322-52529344 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1117246099 14:53888089-53888111 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
1117717188 14:58593439-58593461 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1118034929 14:61856568-61856590 GACTGTGGAAGGAGCGGGTTTGG + Intergenic
1118098014 14:62561158-62561180 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
1118551444 14:66955695-66955717 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1119468908 14:74881640-74881662 TTCTGTGGAAGGGTAGGGGAAGG + Intergenic
1119485596 14:74984773-74984795 GACAGCGGAAGGAGTGGGGATGG + Intergenic
1119594170 14:75918306-75918328 TATTGAGGAAGAAGGGGGGATGG + Intronic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1120569969 14:86105597-86105619 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1120703608 14:87725133-87725155 TACTGTGAAAGAAGGAAGGATGG - Intergenic
1120857921 14:89228949-89228971 TGCTTTGGAAAGAGGCGGGAGGG - Intronic
1121096894 14:91223618-91223640 ATTTTTGGAAGGAGGGGGGATGG + Intronic
1121309604 14:92928475-92928497 TACTGTTGTTGGAGGGGGCAGGG + Intronic
1121316612 14:92964663-92964685 TCCTGTGGGAGGAGGGGCCAAGG - Intronic
1121531422 14:94657436-94657458 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1121728514 14:96170341-96170363 TCCTTGGGAAGGAGGAGGGATGG + Intergenic
1121869488 14:97394212-97394234 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1122129938 14:99598993-99599015 GGCTGGGGAAGGAGGGGGAAAGG + Intronic
1122970459 14:105150106-105150128 TACTTTGGAGGCAGGGGGGAAGG + Intronic
1123822942 15:24049185-24049207 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1123861647 15:24474930-24474952 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1123966052 15:25459429-25459451 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1124466126 15:29941448-29941470 TACTCTGGCTGAAGGGGGGAAGG + Intronic
1124502391 15:30240502-30240524 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1124741174 15:32298147-32298169 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1124943443 15:34240090-34240112 TACTGTGGGGGGAGGGGGGAAGG - Intronic
1125226246 15:37399605-37399627 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1125236035 15:37514769-37514791 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1125409207 15:39387320-39387342 TGAGGTGGAGGGAGGGGGGAGGG + Intergenic
1126131606 15:45347359-45347381 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
1126237851 15:46406717-46406739 GACAGTGGAATGAGGGGGCAAGG + Intergenic
1126298788 15:47171401-47171423 TGCGGTGGTGGGAGGGGGGAGGG + Intergenic
1126918620 15:53494941-53494963 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1126965753 15:54051902-54051924 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1127117021 15:55738885-55738907 GACAGAGGAAGGAAGGGGGAAGG + Intronic
1127192226 15:56542329-56542351 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1127250142 15:57226002-57226024 TAATCTGGGGGGAGGGGGGAGGG - Intronic
1127348026 15:58120761-58120783 TTTTGTGGGGGGAGGGGGGAGGG - Intronic
1127577004 15:60301649-60301671 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1127628246 15:60801268-60801290 AGCTGTCGAAGGAGGGGGGAGGG - Intronic
1127774080 15:62252105-62252127 CACTGTGGGAGGAGGTTGGAGGG + Intergenic
1127966600 15:63927377-63927399 TTCTGTGGGTGGAGGAGGGAAGG - Intronic
1128462569 15:67882369-67882391 AACTGAGCAAGGAGGGGGAAGGG + Intergenic
1128500425 15:68223418-68223440 TACTGAGGAAGGAGCTGGGTGGG - Intronic
1128587341 15:68861077-68861099 GACCGTGGAAAGAGGGGAGAGGG + Intronic
1128593049 15:68919398-68919420 TGCGGTGGGGGGAGGGGGGAGGG + Intronic
1128614044 15:69095578-69095600 GAAGGTGGAAGGAGGGAGGAGGG - Intergenic
1128863717 15:71096172-71096194 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1129008559 15:72395812-72395834 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1129008568 15:72395842-72395864 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1129266302 15:74395334-74395356 TACTGCTGAAGGAGGCAGGATGG - Intergenic
1129347829 15:74935383-74935405 CACTTTGGAAGGTGGGAGGAGGG + Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129475013 15:75779252-75779274 TGCTGTGAAAGGAGGTTGGAGGG - Intergenic
1129555365 15:76502572-76502594 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1129838791 15:78730846-78730868 TGCTGTGAAAGGAGGTTGGAGGG - Intergenic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130205329 15:81870233-81870255 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1130230843 15:82095369-82095391 TAGGCTGGAAGGAGGTGGGAGGG - Intergenic
1130259927 15:82346762-82346784 TGCTGTGGGAGGAGGTTGGAGGG + Intronic
1130268798 15:82432674-82432696 TGCTGTGGGAGGAGGTTGGAGGG - Intronic
1130281302 15:82522247-82522269 TGCTGTGGGAGGAGGTTGGAGGG - Intergenic
1130472677 15:84238430-84238452 TGCTGTGGGAGGAGGTTGGAGGG - Intronic
1130480168 15:84353001-84353023 TGCTGTGGGAGGAGGTTGGAGGG - Intergenic
1130484397 15:84390572-84390594 TGCTGTGGGAGGAGGTTGGAGGG - Intergenic
1130491601 15:84435128-84435150 TGCTGTGGGAGGAGGTTGGAGGG + Intergenic
1130503216 15:84514168-84514190 TGCTGTGGGAGGAGGTTGGAGGG + Intergenic
1130577787 15:85107581-85107603 CCCAGTGGAAGGAGAGGGGAGGG + Intronic
1130594971 15:85243064-85243086 TGCTGTGGGAGGAGGTTGGAGGG - Intergenic
1131296544 15:91154438-91154460 GATTGTGGAAGGAGCAGGGAGGG + Intronic
1131308979 15:91270773-91270795 TCCTGTGGATGATGGGGGGATGG + Intronic
1131308987 15:91270800-91270822 TCCTGTGGATGATGGGGGGATGG + Intronic
1131308995 15:91270827-91270849 TCCTGTGGATGATGGGGGGACGG + Intronic
1131324522 15:91429648-91429670 TACTGTGGAAGGTGGCAAGATGG + Intergenic
1131475966 15:92739616-92739638 TGCAGTGGAGGGATGGGGGAGGG + Intronic
1131726148 15:95227447-95227469 TCCTGTGAGAGGATGGGGGAAGG + Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1131832877 15:96365594-96365616 TACTGTGGACGGAGTGGGGTGGG - Intergenic
1132168224 15:99619057-99619079 TATTGAGGATGGAAGGGGGAAGG + Intronic
1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG + Intergenic
1132584322 16:699771-699793 GGCTGTGGCAGGAGGGGGCAGGG - Intronic
1132721611 16:1319245-1319267 TGCTGTGGAATGTGGGGTGACGG - Intronic
1132744641 16:1431597-1431619 GCCTGTGGCAGGAGGGCGGAGGG - Intergenic
1132781762 16:1630517-1630539 TGCTGTGGAGGCAGGGTGGAGGG - Intronic
1132806119 16:1775963-1775985 TGCTGCAGAAGGCGGGGGGAGGG - Exonic
1133157513 16:3885538-3885560 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1133211876 16:4267839-4267861 TAGTGTAGAAGCAGCGGGGATGG - Intronic
1133272823 16:4619022-4619044 GATGGTGGAAGGAGGGGTGAAGG - Intronic
1133442784 16:5835066-5835088 TTTTGTGAAAGGAGGTGGGATGG + Intergenic
1133827573 16:9292027-9292049 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1133833546 16:9346532-9346554 GACTGGGGATGGAGTGGGGATGG - Intergenic
1135032715 16:19051393-19051415 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1135631566 16:24039616-24039638 TGCTGGGGATGGAGGTGGGAAGG + Intronic
1136648372 16:31643385-31643407 GAATGTGGAAGGTGGGAGGAGGG - Intergenic
1138790861 16:59902484-59902506 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1139078277 16:63482319-63482341 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1139376628 16:66502767-66502789 TACTGTGGAAGGAGGGGGGAAGG - Intronic
1139490449 16:67283224-67283246 TCCTGTGGCAGGATGGAGGACGG + Intronic
1139918204 16:70441006-70441028 TAATGTGGAGGGAGGAGGGTGGG - Intergenic
1140543487 16:75783170-75783192 GGCTGTGGGAGGAGGGTGGATGG - Intergenic
1140767047 16:78169686-78169708 TCCTGTGGAAGAAGGAGGTAGGG + Intronic
1141174467 16:81709925-81709947 TTCTGGGGGCGGAGGGGGGAGGG + Exonic
1141239109 16:82248629-82248651 AGCTGTGGAAAGAGAGGGGAAGG + Intergenic
1141804090 16:86331194-86331216 TCCTCTGGAAGGAGCGGAGAGGG + Intergenic
1141989797 16:87603189-87603211 TACTGTGGAGGCTGGGAGGACGG + Exonic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142246425 16:88972209-88972231 TACTGGGGAGGGAGGGAGGGAGG + Intronic
1142532780 17:594159-594181 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1142659022 17:1414828-1414850 TACGGTGGCAGCAGTGGGGAGGG + Intergenic
1142669765 17:1482745-1482767 TAGTGTGGGAGGGGAGGGGAGGG - Intronic
1143931488 17:10432863-10432885 TACAGTGAAAGGAGTGGGCATGG - Intergenic
1143983316 17:10889737-10889759 TAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1144292656 17:13841514-13841536 TCCTGTGGCAGGAGGTAGGATGG - Intergenic
1144621496 17:16821373-16821395 TGATGTGGGAGCAGGGGGGAGGG + Intergenic
1145684822 17:26641524-26641546 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1145727836 17:27148486-27148508 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1146240613 17:31219624-31219646 TACTTAGGGGGGAGGGGGGAGGG - Intronic
1146304705 17:31722093-31722115 TGCTGTGGAATGAGGTGGGGTGG + Intergenic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1146740764 17:35281483-35281505 TACGGTGGGGGGAGGGGGGAGGG + Intergenic
1147187705 17:38721857-38721879 TCCTGGGGAGGGAGGGGGAAGGG - Exonic
1147247664 17:39132773-39132795 TACTGAGGAACGATGGAGGAAGG + Intronic
1147573468 17:41585687-41585709 TAATGTGGGAGCAGGGAGGAGGG + Intronic
1147718018 17:42521152-42521174 CACTGTGGAGGGAGGCGGGGAGG - Exonic
1148191478 17:45681552-45681574 TAGTGTGGGAGGTGGGTGGAGGG - Intergenic
1149572217 17:57680441-57680463 CTCTGTGGAAGGAGGCGGGAAGG + Exonic
1149623115 17:58060803-58060825 CACTGCGGATGGAGGGGGGCGGG + Intergenic
1151075677 17:71269606-71269628 CAATGTGGAAAGAGGGGGAAGGG - Intergenic
1151086793 17:71389533-71389555 CACTGTGGTAGGAGAGGGCAAGG - Intergenic
1151386541 17:73758542-73758564 GCCTGGGGAAGGAGGAGGGAGGG + Intergenic
1151556483 17:74849456-74849478 GACTGTGGAACGAGTGGGGGAGG - Intronic
1151887941 17:76934100-76934122 GACTGAGGAAGGAGGAGAGAAGG + Intronic
1152205110 17:78970469-78970491 GACTGTGGAAGCTGGGAGGAGGG - Intergenic
1152226854 17:79096759-79096781 TGCTGAGGAGGGAGGGGGCACGG + Intronic
1152354328 17:79799332-79799354 CACTGTGGAAGTGGGAGGGAGGG + Intronic
1152524311 17:80878954-80878976 GCCTGGGGAAGGAGGAGGGACGG - Intronic
1152637995 17:81438021-81438043 TTTTGTGGGAGGAGGGGGCACGG - Intronic
1153024829 18:662655-662677 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1153028701 18:693418-693440 TACTTTGGAAGGCTGGAGGATGG - Intronic
1153094552 18:1385372-1385394 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1153173734 18:2346446-2346468 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1153370447 18:4309443-4309465 AACAGTAGAAGGAGGGGGCATGG + Intronic
1153372526 18:4335313-4335335 TGCTGTGGAAGGTGGGAGGGAGG - Intronic
1153848635 18:9072404-9072426 TACTGGGGAAGGCTGGGGAAGGG - Intergenic
1154099434 18:11456196-11456218 TAGGGTGGGAGGAGGGGGGAGGG + Intergenic
1154480452 18:14818502-14818524 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
1155093677 18:22535507-22535529 TGGGGTGGTAGGAGGGGGGAGGG + Intergenic
1155383097 18:25246076-25246098 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1155595497 18:27481372-27481394 TACTGTGAAAGGAGTAGGGAGGG - Intergenic
1155628444 18:27863187-27863209 TACTATGGAAGTAGAGGGAATGG - Intergenic
1155831187 18:30516390-30516412 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1156195159 18:34766523-34766545 TGGTGTGGGAGGAAGGGGGAGGG + Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1157944780 18:51967053-51967075 TGTTGTGGAGTGAGGGGGGAGGG - Intergenic
1158062660 18:53365066-53365088 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1158113922 18:53973908-53973930 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1158459509 18:57633855-57633877 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1158819726 18:61145597-61145619 GACTGTGGTAGGGGGGGGGAGGG + Intergenic
1158952047 18:62503893-62503915 TAGAGTGGGAGGAGGAGGGAGGG + Intergenic
1159174996 18:64821212-64821234 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1159178147 18:64865951-64865973 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1159217820 18:65419533-65419555 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1159728372 18:71992932-71992954 TGCGGTGGGAGGATGGGGGAGGG + Intergenic
1160179202 18:76619728-76619750 TACTGTGGGAGGAGTGGGTCCGG + Intergenic
1160274239 18:77416118-77416140 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1160986183 19:1839998-1840020 CACTGTGAGAGGAGGAGGGAGGG + Intronic
1161210668 19:3063562-3063584 GGCTGTGGGAGGAGGAGGGACGG + Intergenic
1161265962 19:3364751-3364773 TACAGGGGAGGGAGGGTGGAAGG + Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1161582930 19:5090654-5090676 TACTGTCGGCGGTGGGGGGAAGG - Intronic
1161950248 19:7463797-7463819 GACTGTGGAAGGAAGGGGACAGG - Exonic
1162216308 19:9136825-9136847 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1162599649 19:11658205-11658227 TGCTGTGGAGGAAGGGGGTAGGG + Intergenic
1162665415 19:12206334-12206356 GACAGTGGAAGGTGGGAGGAGGG - Intergenic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1163588454 19:18176803-18176825 CACTGTGGAAGGAGGATGAAGGG + Intronic
1163600915 19:18248443-18248465 GGCAGAGGAAGGAGGGGGGAAGG + Intronic
1163627858 19:18401134-18401156 TACAGTGAGAGGTGGGGGGAGGG - Intergenic
1163717704 19:18881547-18881569 CTCTGTGGAAGGACAGGGGATGG - Intronic
1163722827 19:18906374-18906396 CTCTGTGGATGGAGGTGGGATGG + Intronic
1163783077 19:19260759-19260781 TTCTGAGGAAGGAGGGGGGCGGG - Intronic
1164348622 19:27302251-27302273 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1164395891 19:27862644-27862666 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1164568921 19:29354312-29354334 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1164594779 19:29525890-29525912 GGCTGTGGCAGGAGAGGGGAGGG + Intergenic
1165280981 19:34796954-34796976 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1165384028 19:35500028-35500050 TTCTGTGGAAGAAGTGGGCATGG + Exonic
1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG + Exonic
1166104563 19:40590876-40590898 TTCTGTGCAATGAGGGGAGAGGG + Intronic
1166569537 19:43784898-43784920 TTCTGAGGGAGGAGGGGGGCTGG + Intergenic
1167550299 19:50155686-50155708 AACTGTGGGAGGAGGGGTCAAGG - Intronic
1167757546 19:51421887-51421909 TCCTGAGGAGGGAGGGGCGAGGG + Intergenic
1167795393 19:51704957-51704979 TTCTGAGGGAGGAGGGGGCAGGG - Intergenic
1168093335 19:54100221-54100243 TACTGAGACAGGAGGAGGGAGGG - Intronic
1168257153 19:55173353-55173375 TGGGGTGGAAGGTGGGGGGAGGG + Exonic
1202631919 1_KI270706v1_random:7986-8008 TGGTGTGGAAGGAGGGGGGAGGG - Intergenic
1202653901 1_KI270707v1_random:31677-31699 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
925856159 2:8131791-8131813 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
925862625 2:8194564-8194586 TACTTTGGAAGGAGGATGGAGGG - Intergenic
926366772 2:12140397-12140419 CACTGCGGCAGGTGGGGGGAGGG + Intergenic
926452616 2:13024089-13024111 TGCTGTGGAAGGAGGGAGGAAGG + Intergenic
926499922 2:13641511-13641533 TGGGGTGGCAGGAGGGGGGACGG - Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
927201876 2:20583089-20583111 TCCTGAGCAAGGAGGGGCGATGG + Intronic
927430777 2:23024743-23024765 CGCTGTGGAAGGAGGGGTGGGGG - Intergenic
927480104 2:23446817-23446839 TATTGTCGAAAGAGGAGGGAAGG + Intronic
927856340 2:26530098-26530120 TACTGGGGATGAAGAGGGGAGGG + Intronic
928231126 2:29499876-29499898 AACAGGGGAAGGAGAGGGGAAGG - Intronic
928479187 2:31664305-31664327 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
928621807 2:33096980-33097002 TAGGGTAGAAGGAGTGGGGATGG + Intronic
928720341 2:34113994-34114016 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
928816144 2:35296523-35296545 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
928845773 2:35670067-35670089 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
929410245 2:41691220-41691242 TAATGTGCAAGGAGGTGGGAGGG + Intergenic
931048233 2:58381681-58381703 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
931654656 2:64500194-64500216 TACTGGGGAAGTAGGGGAGGTGG + Intergenic
931951078 2:67362102-67362124 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
931975143 2:67636041-67636063 TGGGGTGGAGGGAGGGGGGAAGG - Intergenic
932123478 2:69122735-69122757 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
932314346 2:70769490-70769512 GAGTGTGGAAGGAGGGTGCAGGG - Intergenic
932438366 2:71716504-71716526 TTCAGGGGAAGGAGGGGGTATGG + Intergenic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
933263465 2:80155490-80155512 AACTGGGGAGGGAGGTGGGAAGG - Intronic
933402977 2:81822222-81822244 TAATGTGGCAGAAGGGAGGAGGG - Intergenic
933529927 2:83495420-83495442 TAGGGTGGGAGGAGGAGGGAGGG + Intergenic
934212633 2:89997372-89997394 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
934507765 2:94907661-94907683 TACTGTGGGTGGAGGGTGGGGGG + Intergenic
934970779 2:98762426-98762448 TACTGTGGAAGGAGGGATGAAGG - Intergenic
935000282 2:99007142-99007164 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
935022881 2:99248583-99248605 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
935345857 2:102107492-102107514 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
935488617 2:103689187-103689209 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
935944785 2:108275803-108275825 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
936025022 2:109024943-109024965 TATTTTGGAAGGAGTGGTGATGG - Intergenic
936072150 2:109378270-109378292 GTCTTTGGAAGGAGGAGGGAAGG - Intronic
936618727 2:114073598-114073620 ACCTGTGGAAGGAGAGAGGATGG + Intergenic
936904770 2:117524783-117524805 TTCTGTGGAAGTAGGGGGCTGGG - Intergenic
937163038 2:119784227-119784249 TTCTGGGGAAGGAGGGGTGGGGG - Intronic
937345214 2:121121161-121121183 GACTGTGGAAGGGGAGGGCAGGG + Intergenic
937645213 2:124258998-124259020 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
938192304 2:129294765-129294787 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
938343339 2:130549599-130549621 GCCTTTGGAAGGAGGGGAGAGGG - Intronic
938346494 2:130571123-130571145 GCCTTTGGAAGGAGGGGAGAGGG + Intronic
938485538 2:131703281-131703303 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
938808712 2:134831295-134831317 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
938922557 2:136008491-136008513 CACTGTGGAAGGCGGGATGAGGG + Intergenic
938933853 2:136111669-136111691 TACTGAGGAAGTAGGGGGCGCGG - Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
940082678 2:149822113-149822135 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
940108703 2:150126902-150126924 TACTGTGGAAGGAAGGGCTCCGG + Intergenic
940524778 2:154799459-154799481 TGCTGAGGAAGGAGGAGGGGTGG + Intronic
940626637 2:156183722-156183744 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
940924672 2:159350907-159350929 TCCGGTGGGGGGAGGGGGGAGGG + Intronic
941053038 2:160757059-160757081 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
941054613 2:160772455-160772477 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
941494990 2:166189090-166189112 TATGGTGGGGGGAGGGGGGAGGG - Intergenic
941753685 2:169162034-169162056 TATGGTGGGAGGATGGGGGAGGG - Intronic
941848916 2:170159535-170159557 GATGGTGGAAGGAGGGGAGAAGG - Intergenic
941986012 2:171512376-171512398 TACTTTGTAGGGAGGGAGGAGGG - Intergenic
942331339 2:174827906-174827928 GACTGTGGAAGGGAAGGGGAAGG + Intronic
942364898 2:175215221-175215243 TGGGGTAGAAGGAGGGGGGAGGG - Intergenic
942394481 2:175532914-175532936 TACCGGGGAAGGAGGGGGCAAGG + Intergenic
943048500 2:182887497-182887519 TAATGTGCAAGGAGGGAGGTTGG + Intergenic
943121653 2:183742993-183743015 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
943426072 2:187735092-187735114 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
943874096 2:193039878-193039900 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
944113405 2:196160239-196160261 AAATGTGAAAGGAGGCGGGAGGG + Intronic
944272387 2:197797742-197797764 TACCTTGCAAGGAGTGGGGAGGG + Intergenic
944340123 2:198586100-198586122 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
944374693 2:199028291-199028313 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
944423965 2:199560209-199560231 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
944438263 2:199714943-199714965 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
944536431 2:200715025-200715047 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
944797783 2:203206428-203206450 GACGGTGGAAAGAGGGGAGAGGG - Intronic
944950765 2:204746122-204746144 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
945649405 2:212539301-212539323 CCCTTTGGAAGGGGGGGGGAAGG - Intergenic
945941801 2:215958106-215958128 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
945982720 2:216326811-216326833 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
946153345 2:217790787-217790809 TGCTGTGTAAGGAGAAGGGAAGG - Intergenic
946198730 2:218057442-218057464 TAATGTGGAATGAAGGAGGAAGG - Intronic
946202090 2:218076401-218076423 TGGGGTGGAAGGAGGGGAGAAGG - Intronic
946202262 2:218077331-218077353 GACTGAGGACTGAGGGGGGATGG - Intronic
946489489 2:220133848-220133870 TACCGTGGATGGACTGGGGAAGG - Intergenic
947141954 2:227027477-227027499 TGGAGTGGGAGGAGGGGGGAGGG + Intronic
947245008 2:228036883-228036905 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
947885442 2:233566148-233566170 CACTGGGGAGGGAGGGGGGAAGG + Intronic
948187648 2:236034395-236034417 TGCTGTGGAAAGAGGGGTGGGGG - Intronic
948363879 2:237442078-237442100 TACTCTGGAAGGGAGGAGGATGG - Intergenic
948403786 2:237702764-237702786 TACTGGGCAAGGAGGTGGCAGGG + Intronic
948921612 2:241068592-241068614 CACTGTGCAGGGATGGGGGACGG - Intronic
949049662 2:241890791-241890813 TTCTAAGGAATGAGGGGGGATGG + Intergenic
1168761667 20:353904-353926 TGCAGAGGAAGGAGTGGGGACGG - Exonic
1168854145 20:997187-997209 CACTGAGGAAGGAGGGAGGCGGG - Intronic
1168955167 20:1829615-1829637 TGCTGTGAAAGGATGGGGCAGGG + Intergenic
1169150629 20:3286693-3286715 TACTGAGGAAGGAGGCAGGTGGG - Intronic
1169576555 20:6968911-6968933 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1170018809 20:11813062-11813084 TTCCATGGATGGAGGGGGGATGG + Intergenic
1170569709 20:17625793-17625815 TGCTCTGGATGGCGGGGGGAGGG - Intronic
1170690098 20:18606770-18606792 GACTGTGGTGGGGGGGGGGAGGG + Intronic
1170764558 20:19279146-19279168 CACTGTGGAAGTAGAGGAGAGGG + Intronic
1170848683 20:19984020-19984042 TTGGGTGGGAGGAGGGGGGAGGG - Intronic
1171065962 20:22015433-22015455 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1171076806 20:22135177-22135199 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1171188385 20:23139985-23140007 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171515581 20:25730058-25730080 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171825601 20:29900922-29900944 TGTTGTGGGATGAGGGGGGAGGG - Intergenic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1171895321 20:30752999-30753021 TACTGTGGGTGGAGGGTGGGGGG + Intergenic
1172022091 20:31921823-31921845 TGGGGTGGAAGGAGGGGGGAGGG + Intronic
1172055311 20:32150601-32150623 AACTGTGGAGGGAGGGAGGGAGG - Exonic
1172157842 20:32841607-32841629 TGCGGTGGGGGGAGGGGGGAGGG - Intronic
1172410470 20:34718150-34718172 TACTGTGGTTGGTGGGGAGAAGG + Intronic
1172588430 20:36101161-36101183 AACTCTGGAAGAAGTGGGGAGGG + Intronic
1172717943 20:36977731-36977753 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172838464 20:37887839-37887861 AACTGTGGTGGGAGGGAGGATGG + Intergenic
1172907071 20:38378181-38378203 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1172918757 20:38462579-38462601 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1172918768 20:38462615-38462637 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1172924808 20:38523391-38523413 TACTTTGGTAGTAGGGGAGAAGG + Intronic
1172980866 20:38940565-38940587 TACTGTGGAAATGGGGAGGAAGG + Intronic
1173628965 20:44495663-44495685 TACTGTGTAAGGAGGGGGCAGGG - Intergenic
1174791025 20:53478512-53478534 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1175237582 20:57525226-57525248 TACTGTGGGGGCAGGGGGGAAGG + Intronic
1175314313 20:58036744-58036766 TACTTTTGGAGGAGTGGGGATGG + Intergenic
1175503485 20:59466469-59466491 TACTTTGGGAGGAAGGGGGCAGG - Intergenic
1175526781 20:59639710-59639732 TGCTGAGGGAGGAGGGGAGAAGG + Intronic
1175594686 20:60221693-60221715 AATTGTGGAAGGAGAGGGGCCGG + Intergenic
1175842326 20:62036925-62036947 GAGTGTGGAAGGAAGGGGCAAGG - Intronic
1175914848 20:62421050-62421072 ATCTGTGGGAGGAGGGGGAAGGG - Intronic
1176051569 20:63122474-63122496 TACAGTGGAAAGAGGGAGGCGGG - Intergenic
1176317975 21:5268227-5268249 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1176475838 21:7205002-7205024 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1176644135 21:9333862-9333884 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1176930692 21:14806094-14806116 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1177045281 21:16161320-16161342 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1177083918 21:16677850-16677872 TGCTTTTGAAGGAGGGGGTAAGG - Intergenic
1177309833 21:19376032-19376054 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1177392633 21:20496047-20496069 TGCTGTTGGGGGAGGGGGGAGGG - Intergenic
1178617244 21:34144914-34144936 TACAGAGGATGGAGTGGGGAGGG + Intergenic
1179114394 21:38476699-38476721 TAGTCTACAAGGAGGGGGGAAGG - Intronic
1179300239 21:40101771-40101793 TACTGTGGGAGGTGGTGGGGGGG + Intronic
1179428401 21:41301037-41301059 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
1179447769 21:41445227-41445249 TGCTGTCGCAGGAGTGGGGAAGG + Intronic
1179547430 21:42122176-42122198 CACTGCTGAAGGAGGGTGGAGGG + Intronic
1179626756 21:42653520-42653542 GACGGGGGAGGGAGGGGGGAGGG + Intergenic
1179709043 21:43201508-43201530 TATTATGGAAGGTGGGGTGAAGG - Intergenic
1179826905 21:43971367-43971389 GACTGTGGGAGGAGACGGGAGGG - Exonic
1180368809 22:11965366-11965388 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1180381663 22:12143966-12143988 TACTGTGGGTGGAGGGTGGGGGG + Intergenic
1180395646 22:12332411-12332433 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1180404099 22:12532340-12532362 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180598510 22:16996802-16996824 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1180723324 22:17925741-17925763 CACTGTGGAAGGAGGGGTGCCGG - Intronic
1181301699 22:21884764-21884786 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1181389565 22:22570547-22570569 TGTTGTGGGGGGAGGGGGGAGGG - Intergenic
1181443131 22:22948898-22948920 TGCTCTGGAAGCATGGGGGAGGG - Intergenic
1181658185 22:24318504-24318526 GACCGTGGAAAGAGGGGAGAGGG + Intronic
1181938394 22:26455582-26455604 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1182127562 22:27827086-27827108 CACTTTGGAAGGTGGGTGGATGG + Intergenic
1182417940 22:30233163-30233185 TCCTGTGGGAGGAGTGGGGGAGG + Intergenic
1182657747 22:31903561-31903583 AGGTGTGGAAGGTGGGGGGAGGG - Intronic
1182660106 22:31919118-31919140 CACTGTGGAAGGTGGGAGGAGGG - Intergenic
1183373858 22:37450825-37450847 TACAGGGGAAGGAAGGGGGTGGG + Intergenic
1183381235 22:37491563-37491585 GACGGGGGAGGGAGGGGGGAGGG + Intronic
1183403483 22:37618427-37618449 ACCTGTGCAGGGAGGGGGGATGG - Exonic
1184073396 22:42161114-42161136 CAATGTGGGGGGAGGGGGGAGGG - Exonic
1184096370 22:42318471-42318493 CATTTTGGAAGAAGGGGGGATGG + Intronic
1184159320 22:42688510-42688532 TTCTGGGAAAGGAGGAGGGAGGG + Intergenic
1184813526 22:46853376-46853398 TACCGTGGAAGGATGGGCGCAGG + Intronic
1184940415 22:47760793-47760815 TACTGTGAAGGGAGGGTGAAGGG + Intergenic
1184948815 22:47824431-47824453 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1185102112 22:48846125-48846147 TCCTTGGGAAGGAGGGGGTATGG + Intronic
949134640 3:549342-549364 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949478684 3:4472665-4472687 ACCTGTGGAAGGAGGGAGGCAGG + Intergenic
949833396 3:8241451-8241473 TTCTCTGGGGGGAGGGGGGAGGG + Intergenic
949848641 3:8398464-8398486 TCCTGTGGAAGGAAGGGGAATGG - Intergenic
949992498 3:9591310-9591332 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
950239105 3:11351992-11352014 TGGCGTGGAGGGAGGGGGGAGGG - Intronic
950880740 3:16321071-16321093 TATAGGGGAAGGAGAGGGGAGGG + Intronic
950998750 3:17532836-17532858 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
951236697 3:20244536-20244558 TAAGGTGGAAGGTGGGAGGAGGG + Intergenic
951679134 3:25275774-25275796 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
951684287 3:25326980-25327002 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
952128892 3:30336379-30336401 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952515501 3:34100061-34100083 TTTGGTGGAGGGAGGGGGGAGGG + Intergenic
952554149 3:34512853-34512875 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
952682095 3:36105415-36105437 TGGTGTGGCGGGAGGGGGGAGGG + Intergenic
952698718 3:36302749-36302771 CACTGTGCAAGGTGCGGGGAGGG - Intergenic
952747794 3:36798082-36798104 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
952975539 3:38692218-38692240 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
953052056 3:39353469-39353491 TAGGGTGGGAGGAGGGGGAAAGG + Intergenic
953154399 3:40355887-40355909 AACTTTGGGAGGAGGGGGGTTGG - Intergenic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
953300923 3:41775071-41775093 TGAGGTGGAGGGAGGGGGGAGGG + Intronic
953692015 3:45127727-45127749 TAAGGTGGAAGGAGTGGGGTGGG - Intronic
954036681 3:47854619-47854641 TACTGTGGAAGGAGGAAGGGAGG + Intronic
954673679 3:52304040-52304062 TAATCTGGAAGGAGGGAAGAGGG - Intergenic
954835944 3:53468102-53468124 TGGGGTGGGAGGAGGGGGGAAGG - Intergenic
955212048 3:56951129-56951151 TGCGGTGGGGGGAGGGGGGATGG + Intronic
955445878 3:59008710-59008732 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
955593979 3:60568457-60568479 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
956781508 3:72606669-72606691 GACTGGGGTAGGAGGGAGGAGGG + Intergenic
956864723 3:73357574-73357596 TACTAGGGAAAGAGGGGGCAGGG + Intergenic
956902206 3:73728692-73728714 TACTGTGGGAGTACAGGGGAGGG - Intergenic
957363265 3:79186713-79186735 TGCAGTGGTAGGAAGGGGGATGG - Intronic
957473004 3:80683959-80683981 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
957537727 3:81528217-81528239 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
957631664 3:82723360-82723382 TGGGGTGGTAGGAGGGGGGAGGG + Intergenic
957660076 3:83138633-83138655 TGGTGTGGGAGGAGGGGGGAGGG + Intergenic
957683654 3:83471953-83471975 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
957719350 3:83973500-83973522 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
957815109 3:85287947-85287969 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
957935591 3:86937505-86937527 CAGTGTGGAAGTAGGGGGAAGGG + Intergenic
958059741 3:88464163-88464185 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
958079148 3:88722998-88723020 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
958127135 3:89370507-89370529 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
958262241 3:91395175-91395197 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
958443163 3:94180836-94180858 TGGGGTGGGAGGAGGGGGGAAGG - Intergenic
958733049 3:97978902-97978924 CACTTTGGAAGGAGTGGGGGTGG + Intergenic
958885788 3:99725556-99725578 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
959601210 3:108188078-108188100 TGGGGTGGGAGGAGGGGGGAAGG - Intronic
959688718 3:109176140-109176162 TAAGGTGGGGGGAGGGGGGAGGG - Intergenic
959849409 3:111070665-111070687 TACTGTGCGAGGCGGGAGGATGG + Intronic
960018882 3:112926322-112926344 AACTGTGGAAGAAAGGTGGAAGG - Intronic
960020942 3:112952636-112952658 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
960194335 3:114746969-114746991 AACTCAGGAAGGAGTGGGGAGGG + Intronic
960515880 3:118602261-118602283 GACTGTGGCAGTATGGGGGAGGG - Intergenic
960556832 3:119039400-119039422 AAATGTGGAAGGAGGTGAGAAGG - Intronic
960563047 3:119106728-119106750 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
960948607 3:122983888-122983910 TGCTGTGGAAGCAGAGGGAAAGG + Intronic
961164064 3:124751331-124751353 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
961219347 3:125187502-125187524 TGCTGTGGGAGGAGGGGAGGTGG - Intronic
961395550 3:126586142-126586164 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
961444807 3:126974802-126974824 TACTGTGAAAGGAGGGCCAAAGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961635720 3:128331244-128331266 TACTGAGGAAGGGGGGAAGAGGG - Intronic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
961646818 3:128397184-128397206 TCCTGTGGAAGGAGGGAGGATGG - Intronic
962997269 3:140642951-140642973 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
963080375 3:141386948-141386970 CACTGGGGAAGGAGGAGGCAAGG - Intronic
963256797 3:143152998-143153020 GACTGGGGCAGGAGGGAGGAGGG - Intergenic
963599004 3:147361131-147361153 AAAGGAGGAAGGAGGGGGGAGGG - Intergenic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
963755621 3:149232387-149232409 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
963868723 3:150390513-150390535 AAAAGTGGAGGGAGGGGGGAAGG - Intergenic
964059727 3:152506211-152506233 TGCTGTGGTAGGTGGGAGGACGG + Intergenic
964173194 3:153795037-153795059 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
964468048 3:157020419-157020441 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
964908499 3:161748656-161748678 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
964959518 3:162406006-162406028 TGCGGTGGTGGGAGGGGGGAGGG - Intergenic
964962517 3:162445622-162445644 TGGGGTGGCAGGAGGGGGGAGGG - Intergenic
965039351 3:163485959-163485981 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
965298464 3:166978276-166978298 TGTGGTGGAGGGAGGGGGGAGGG + Intergenic
965800739 3:172491373-172491395 TGGGGTGGTAGGAGGGGGGAGGG - Intergenic
966253620 3:177892562-177892584 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
966342112 3:178937006-178937028 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
966450615 3:180056046-180056068 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
967100498 3:186211525-186211547 CACGGTGGAAGGAGGGCTGAGGG + Intronic
967980519 3:195062491-195062513 CGCTGTGGAAGGAGGCTGGACGG - Intergenic
968084894 3:195869854-195869876 GGCCGTGGAAGGAGGGAGGAGGG + Intronic
968192329 3:196677884-196677906 AACAGTGGAGGGATGGGGGATGG - Intronic
968356020 3:198108050-198108072 AACTGGGGAAGGAGGGAGGGAGG + Intergenic
1202742753 3_GL000221v1_random:71206-71228 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
968535507 4:1125487-1125509 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
968538261 4:1148776-1148798 GACTGAGGCAGGAGGGTGGAAGG - Intergenic
968941395 4:3640548-3640570 AGCTCTGGAAGGAGGGTGGACGG + Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969156155 4:5211569-5211591 GACTAGGGGAGGAGGGGGGATGG + Intronic
969162528 4:5273834-5273856 GACTGTGGTGGGTGGGGGGAGGG + Intronic
969383271 4:6822919-6822941 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
969865318 4:10072698-10072720 ACCTGTGGATGGAGAGGGGAGGG - Intergenic
970173543 4:13313245-13313267 GAGTGTGGAAGGTGGGAGGAGGG + Intergenic
970926456 4:21458134-21458156 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
971015321 4:22483110-22483132 ACCTGTGAAAGGAGAGGGGAAGG - Intronic
971249609 4:24962733-24962755 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
971466410 4:26967818-26967840 CACTGTTGGAGGAGGGGGGAGGG - Intronic
971518044 4:27513121-27513143 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
971643294 4:29163014-29163036 TACTGTGGAAAGTGGGGGGGGGG + Intergenic
971812322 4:31442028-31442050 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
971867544 4:32191398-32191420 TGCAGTGGGGGGAGGGGGGAGGG + Intergenic
972288113 4:37668228-37668250 GACCGTGGAAAGAGGGGAGAGGG - Intronic
973003196 4:44977249-44977271 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
973068341 4:45825070-45825092 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
973193326 4:47411495-47411517 TAGTGAGGAAGGATGTGGGATGG + Intronic
973389421 4:49542817-49542839 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
973632047 4:52828743-52828765 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
974145865 4:57946311-57946333 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
974330229 4:60468268-60468290 TGGGGTGGAAGGAGGGGGGAGGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974377543 4:61097730-61097752 TTGGGTGGAGGGAGGGGGGAGGG - Intergenic
974427008 4:61754760-61754782 TGGTGTGGGGGGAGGGGGGAAGG - Intronic
974568408 4:63609911-63609933 TGCGGTGGGGGGAGGGGGGAAGG - Intergenic
974578189 4:63756595-63756617 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
974800269 4:66808396-66808418 CTCTGTGGAAGGAGGGAGCATGG - Intergenic
974952151 4:68596136-68596158 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
975016548 4:69429072-69429094 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975039373 4:69725872-69725894 TGGGGTGGAGGGAGGGGGGAAGG + Exonic
975119691 4:70715156-70715178 TTCTGGGAAAGGAGGTGGGAGGG + Intronic
975492722 4:75006283-75006305 TAGGGTGGGGGGAGGGGGGACGG - Intronic
975682669 4:76892204-76892226 TACTGTGGAAGGAGATGTGAGGG - Intergenic
976511661 4:85917053-85917075 TGGGGTGGAGGGAGGGGGGAAGG - Intronic
976615905 4:87076617-87076639 TAATATGGATGGAGGGGTGATGG - Intronic
976848646 4:89519126-89519148 TACCGGGGCAGGAGGGAGGATGG - Intergenic
976957426 4:90917512-90917534 TGGGGTAGAAGGAGGGGGGAGGG + Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977613848 4:99065530-99065552 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
977852901 4:101851535-101851557 TAGAGTAGAAGGAGAGGGGAAGG + Intronic
977992632 4:103462800-103462822 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
978021890 4:103824697-103824719 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
978660587 4:111121369-111121391 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
978997804 4:115177718-115177740 TGCAGTGGGGGGAGGGGGGAGGG + Intergenic
979121677 4:116910193-116910215 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
979578939 4:122332779-122332801 GACTGTGGGGGGTGGGGGGAGGG - Intronic
980149625 4:129029527-129029549 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
980401146 4:132287694-132287716 AACTGGGGAAGGAGTGGGGTTGG + Intergenic
980456831 4:133055007-133055029 CACTGTGGGGGGAGGGGGGAGGG + Intergenic
980604452 4:135071211-135071233 GACTGTTGTGGGAGGGGGGAGGG + Intergenic
981284284 4:142996887-142996909 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
981408661 4:144401816-144401838 TGCTGGGGAAGGAGAGGGTATGG + Intergenic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981677290 4:147357217-147357239 GACTGTGGAAAGAGGGGAGAGGG - Intergenic
981677302 4:147357263-147357285 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
981808428 4:148744871-148744893 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
982279435 4:153668243-153668265 TACTGTGGTAGGAAGGTGGAGGG + Intergenic
982674718 4:158362697-158362719 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
982960323 4:161827631-161827653 TGCTGTGGAAGATGGGGGCATGG + Intronic
983503146 4:168523264-168523286 AAGGGAGGAAGGAGGGGGGAGGG + Intronic
983608307 4:169615359-169615381 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
983672532 4:170254958-170254980 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
983953709 4:173673235-173673257 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
984066086 4:175049544-175049566 TGGGGTGGTAGGAGGGGGGAGGG - Intergenic
984134338 4:175916821-175916843 TAATGTGGAAGGAGGGGCTTGGG - Intronic
984306693 4:178000884-178000906 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
984380413 4:178985917-178985939 TCAGGTGGGAGGAGGGGGGAGGG - Intergenic
985736266 5:1585422-1585444 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
985938899 5:3118479-3118501 AACTGCAGAAGGAGGGTGGAGGG - Intergenic
986152996 5:5144911-5144933 AACTGTGGAAAGAGTGGGAAGGG + Intronic
986231683 5:5869972-5869994 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
986233372 5:5886318-5886340 TACTGTGGAAAAGGGAGGGAGGG - Intergenic
986380683 5:7182621-7182643 TACTCTGGAAAGAAGAGGGAGGG - Intergenic
986534678 5:8774898-8774920 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
986553832 5:8990088-8990110 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
986699576 5:10392814-10392836 AACTGTGGTGGGAGGGAGGAGGG - Intronic
986912807 5:12577307-12577329 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
987037383 5:14031991-14032013 CACTGTGAATGGAGGGGGCACGG - Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987247116 5:16060234-16060256 ACCTGTGGGAGGAGTGGGGATGG - Intergenic
987305399 5:16632790-16632812 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
987787800 5:22524951-22524973 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
987914238 5:24190781-24190803 TAGGGTGGGGGGAGGGGGGACGG - Intergenic
988114528 5:26867626-26867648 TGCCGTGGGGGGAGGGGGGAGGG - Intergenic
988669190 5:33362699-33362721 TACTAAGGGAGGAGGGGTGAGGG + Intergenic
988749040 5:34176253-34176275 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
988913071 5:35865101-35865123 ATAGGTGGAAGGAGGGGGGAGGG - Intronic
989560466 5:42844450-42844472 TTGGGTGGAGGGAGGGGGGAAGG - Intronic
989661082 5:43798295-43798317 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
990022327 5:51142888-51142910 TGGGGTGGAAGGATGGGGGAGGG + Intergenic
990477543 5:56175698-56175720 AACTGGGGAAGGTGGTGGGAGGG - Intronic
990560921 5:56982135-56982157 CCCTGTGGTTGGAGGGGGGAAGG - Intergenic
991398285 5:66227131-66227153 TACTGTGTCAGGAGGTGGGTGGG + Intergenic
991555979 5:67895465-67895487 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
991635625 5:68702042-68702064 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
991748165 5:69768470-69768492 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991799747 5:70348315-70348337 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991828850 5:70661723-70661745 TAGGGTGGAGGGATGGGGGAGGG + Intergenic
991892103 5:71347746-71347768 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
992198107 5:74359568-74359590 TACAGTGGAGGGTGAGGGGAAGG + Intergenic
993283574 5:85960137-85960159 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
993408869 5:87549328-87549350 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
993607761 5:90014817-90014839 TACTGTGCAGGGAGGGGTGGTGG - Intergenic
993885464 5:93410622-93410644 TTCTGTGGATGGTGTGGGGATGG - Intergenic
994135991 5:96287242-96287264 GACAGTGGAAGGAAAGGGGAGGG - Intergenic
994280528 5:97897297-97897319 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
994471132 5:100209622-100209644 TACTATGGGAGGAAAGGGGAAGG + Intergenic
994621388 5:102166951-102166973 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
994869028 5:105319896-105319918 AACTGAGGAAGGAGAAGGGAAGG - Intergenic
995123777 5:108560113-108560135 GACCGTGGAAAGAGGGGAGAAGG + Intergenic
995186492 5:109277160-109277182 TGGGGTGGCAGGAGGGGGGAGGG + Intergenic
995339385 5:111040320-111040342 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
995495515 5:112737955-112737977 TGCTGCGGGGGGAGGGGGGAAGG + Intronic
995874289 5:116774255-116774277 TACTGTACAAGGAGGGGAAATGG - Intergenic
995878040 5:116811997-116812019 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
995991590 5:118246645-118246667 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
996020844 5:118589312-118589334 TTCTGTGGAAGGGGTGGGCAGGG - Intergenic
996030748 5:118701976-118701998 TCCTTTGGAAGGAGGGGTGAGGG + Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996157523 5:120119970-120119992 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
996171131 5:120293178-120293200 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
996178548 5:120390256-120390278 TACTTTGTTAGGAGGGAGGAAGG - Intergenic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
996958022 5:129209051-129209073 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
997186478 5:131886943-131886965 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
997310688 5:132878468-132878490 TATTGAGGAGGGAGGGGGGAAGG + Exonic
997585668 5:135041549-135041571 TAGCGTGCAGGGAGGGGGGAAGG - Intronic
998114705 5:139527283-139527305 TACTGTGGGGAGAGGGGGAAGGG - Intronic
998309325 5:141111507-141111529 TTGTGTGGTGGGAGGGGGGAGGG - Intronic
998430320 5:142064776-142064798 CACTGTGGAAGGAGAGGGGAGGG - Intergenic
999127444 5:149256353-149256375 TACTATGGAAGGAGCAGAGAAGG + Intronic
999188838 5:149731591-149731613 AACAGTGGAAGGGAGGGGGAAGG + Intronic
999359398 5:150970114-150970136 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
999498270 5:152121812-152121834 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
999542944 5:152593939-152593961 AATTGGGGATGGAGGGGGGATGG - Intergenic
999553381 5:152715183-152715205 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
999672905 5:153973252-153973274 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
999860400 5:155639574-155639596 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1000248412 5:159469682-159469704 TACTGTGGCAGGAAGAGGGCAGG - Intergenic
1000459839 5:161500975-161500997 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1000921974 5:167149159-167149181 TAGGGTGGGTGGAGGGGGGAGGG - Intergenic
1001589757 5:172857328-172857350 TACTGAGGAAGGATGGTGCATGG - Intronic
1003241748 6:4351212-4351234 TGCTGGGGAAGGAGGGGAAATGG - Intergenic
1003384192 6:5652294-5652316 GACTGTGGCAGGATAGGGGATGG + Intronic
1004808158 6:19226817-19226839 TCGGGTGGAGGGAGGGGGGAGGG + Intergenic
1004840341 6:19576753-19576775 TGCAGTGGGGGGAGGGGGGAGGG + Intergenic
1004841091 6:19586108-19586130 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1005245954 6:23885441-23885463 CACTGTGGAAGGAGGGGTGAAGG - Intergenic
1005605774 6:27475669-27475691 AACTGGGGGAGGAGGGGAGAAGG + Intergenic
1005688365 6:28277615-28277637 CACTGGGGAAGGAAGGGGTAAGG - Exonic
1005876091 6:30010558-30010580 TGGTGTGGGAGGAGGTGGGAAGG + Intergenic
1005959349 6:30684799-30684821 TCCTCTGGTGGGAGGGGGGAGGG + Exonic
1006101057 6:31686687-31686709 AACTGAAGAAGGAGGCGGGAGGG + Intergenic
1006388682 6:33746397-33746419 TACAGAGGAAGCTGGGGGGAGGG - Intronic
1006452277 6:34112173-34112195 TAAGATGGAAGGTGGGGGGATGG - Intronic
1006546454 6:34785723-34785745 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1006546472 6:34785784-34785806 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1006546481 6:34785814-34785836 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1006734077 6:36259827-36259849 TACTAGGGAGGGAGGGAGGAGGG + Intronic
1006742919 6:36322205-36322227 TTCTGAGGAAGGAATGGGGAAGG - Intronic
1006917965 6:37608078-37608100 TACTGTGGTAGCAGTGGTGACGG - Intergenic
1007044260 6:38756661-38756683 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1007211338 6:40195487-40195509 AACAGTGGAGGGAGGGGAGATGG - Intergenic
1007248247 6:40477759-40477781 CACTCTGGAAGGAGCAGGGAGGG - Intronic
1007265878 6:40595534-40595556 AGCTGTGAAAGGAGGGTGGAAGG + Intergenic
1007267617 6:40609141-40609163 TACTGTTCAAGGAAGGAGGAAGG - Intergenic
1007479872 6:42142699-42142721 TGTTGTAGAAGGAGGCGGGAAGG - Intergenic
1007521717 6:42455125-42455147 TCCTTTGGAAGGTGGGGGGGGGG - Intergenic
1007593202 6:43035917-43035939 AGCTATGGAAGGAGGGGGAAGGG - Intergenic
1007753833 6:44086077-44086099 TGCTGTGGAGGGTGCGGGGAGGG - Intergenic
1008067278 6:47062652-47062674 CACTCTGGAAGGAGAGGGGCAGG + Intergenic
1008117606 6:47570285-47570307 TAATGAAGAAGGAGGAGGGAGGG + Intronic
1008274921 6:49531953-49531975 TACTGAGGTGGGAGGGGGTAAGG - Intergenic
1008532657 6:52478275-52478297 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1008799315 6:55346542-55346564 TGGGGTGGTAGGAGGGGGGAGGG + Intronic
1008835121 6:55817600-55817622 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1009304403 6:62070480-62070502 TAGGGTGGGAGGAGGGGGGAGGG - Intronic
1009323324 6:62318044-62318066 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1009333117 6:62450467-62450489 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1009398106 6:63226115-63226137 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1009454172 6:63835052-63835074 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1009483978 6:64196744-64196766 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1009613581 6:65976988-65977010 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1009614155 6:65983326-65983348 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1009813536 6:68700821-68700843 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1010121467 6:72380247-72380269 TGGGGTGGAAGGATGGGGGAGGG + Intronic
1010271773 6:73923507-73923529 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1010319632 6:74490674-74490696 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1010441432 6:75899876-75899898 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
1010472207 6:76241976-76241998 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1010477309 6:76303878-76303900 GAGTGTGGAGGGAGGAGGGAAGG - Intergenic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1010683638 6:78825575-78825597 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1011476285 6:87752092-87752114 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1011971232 6:93225237-93225259 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1012250102 6:96970390-96970412 TCCTGTGGCAGGAGGGAGCATGG - Intronic
1012564106 6:100623966-100623988 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1012721562 6:102753028-102753050 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1012729056 6:102857017-102857039 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
1012785816 6:103624385-103624407 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1012904254 6:105046157-105046179 TGGGGTGGAGGGAGGGGGGACGG - Intronic
1013442943 6:110190191-110190213 TCCTGAGGCAGGAGGAGGGAAGG + Intronic
1013783091 6:113749985-113750007 TACAGAGGAAGGAGTGGTGATGG + Intergenic
1013909463 6:115256077-115256099 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1014083038 6:117310153-117310175 TACTATAGAAAGAGAGGGGAAGG - Exonic
1014084774 6:117330234-117330256 CACTGAGGAAGGATGGGTGAGGG - Intronic
1014101577 6:117517393-117517415 GCCTGTGGAAGCAGTGGGGAGGG - Intronic
1014129619 6:117816035-117816057 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1014150599 6:118050215-118050237 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1014157554 6:118128661-118128683 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1014255430 6:119156342-119156364 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1014318659 6:119898202-119898224 TGGTGTGGAAGTACGGGGGAGGG - Intergenic
1014588411 6:123230387-123230409 TGCGGTGGGAGGAGGGGGGAGGG + Intronic
1014730422 6:125025511-125025533 TACCGAGGAGGGAGGGAGGAAGG + Intronic
1014850318 6:126332582-126332604 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1015080689 6:129222483-129222505 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
1015273184 6:131358121-131358143 GACTGTGAAAGGTGGGGAGAAGG + Intergenic
1015435126 6:133177274-133177296 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1016106104 6:140164125-140164147 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016519755 6:144933634-144933656 TGCTGGGGCAGGAGGGAGGATGG - Intergenic
1016794940 6:148107886-148107908 TACTGTGGATGTAGGTTGGAGGG - Intergenic
1016935300 6:149445379-149445401 TCCTGTGGGAGGAAGGTGGAAGG - Intergenic
1017125769 6:151062884-151062906 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1017206626 6:151809208-151809230 CACTGTGGAAGGAGCGCGGCCGG + Intronic
1017272099 6:152518987-152519009 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1017330835 6:153196528-153196550 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1017637075 6:156454137-156454159 TACTGTGGAAGGCAGGGGGTGGG - Intergenic
1017798672 6:157871528-157871550 TCGGGTGGGAGGAGGGGGGAGGG + Intronic
1017931910 6:158963402-158963424 GAAGGGGGAAGGAGGGGGGAGGG - Intergenic
1018284515 6:162222999-162223021 TGCGGTGGGGGGAGGGGGGAGGG - Intronic
1018356546 6:163023216-163023238 GAGGGTGGAAGGAGGGGGGTGGG - Intronic
1018494872 6:164338605-164338627 TACTGCCGAAGGAGGAGGAAGGG - Intergenic
1018931859 6:168245245-168245267 TACAGTGGCAAGAGTGGGGATGG - Intergenic
1019097769 6:169599129-169599151 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1019706093 7:2497954-2497976 TGCTGGGGAAGGAGGGGGCGTGG + Intergenic
1020179854 7:5913798-5913820 GTCTGTGCAAGGATGGGGGAAGG - Intronic
1020303082 7:6811086-6811108 GTCTGTGCAAGGATGGGGGAAGG + Intronic
1020592526 7:10159244-10159266 TACTGTGGAAGAAGAAGGGCAGG + Intergenic
1020645104 7:10806037-10806059 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1021069831 7:16222294-16222316 TGCGGTGGGGGGAGGGGGGAGGG + Intronic
1021120594 7:16791051-16791073 GACCGTGGAAAGAGGGGGGGGGG + Intergenic
1021334783 7:19385926-19385948 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1021417773 7:20407975-20407997 TATTGTGCAAGGAGAGGGAAAGG + Intronic
1021602584 7:22378978-22379000 TCCTGTGGTAGGAGTGAGGAGGG - Intergenic
1022171300 7:27834592-27834614 TACTGGGGCAGGAAAGGGGAGGG + Intronic
1022304119 7:29130170-29130192 GACTATGGAAGGAGTTGGGATGG + Intronic
1022451863 7:30523342-30523364 CACTGTGGGAGGAGGTTGGAGGG + Intronic
1022587272 7:31625622-31625644 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1022900451 7:34803567-34803589 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1022962747 7:35445160-35445182 TACTGAGGAAGCAGTGGGCAGGG - Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023265275 7:38398551-38398573 TAGTGAGGAAGTAGGGGGGATGG + Intronic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023354300 7:39351757-39351779 TACTGGGGCAGGAGGGTGGTGGG - Intronic
1023362238 7:39428964-39428986 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1024152426 7:46585982-46586004 TAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1024172220 7:46801842-46801864 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1024764708 7:52644214-52644236 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1026388729 7:69878267-69878289 TAAGGTGGAGGGAGCGGGGAGGG + Intronic
1026643464 7:72147943-72147965 TGTTGTGGGGGGAGGGGGGAGGG + Intronic
1026762076 7:73134371-73134393 TGCGGTGGAGGGAGGGGGGAGGG + Intergenic
1027038415 7:74943195-74943217 TGCGGTGGAGGGAGTGGGGAGGG + Intergenic
1027085148 7:75258287-75258309 TGCGGTGGAGGGAGTGGGGAGGG - Intergenic
1027539183 7:79446166-79446188 TGCAGTGGGAGGAGGGGGGAGGG + Intronic
1027744429 7:82055763-82055785 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1027988661 7:85329865-85329887 GACTGTGGTGGGTGGGGGGAGGG - Intergenic
1028154568 7:87415207-87415229 TACTGGGCAGGGAGTGGGGAGGG - Intronic
1028168955 7:87572895-87572917 GAGTGTGGAGGGTGGGGGGAGGG + Intronic
1028227624 7:88267377-88267399 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1028254621 7:88578665-88578687 TAGGGTGGAATGAGGTGGGAAGG - Intergenic
1028513928 7:91655870-91655892 TTCTGTGGAGGGAGAGAGGATGG + Intergenic
1028579042 7:92385731-92385753 TGGTGTGGGAGGATGGGGGAAGG + Intronic
1029059653 7:97783861-97783883 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1029197307 7:98814575-98814597 TTCTGTGGAAGAAGGAGGCATGG + Intergenic
1030566048 7:111157581-111157603 TATTGGAGAAGGAGTGGGGATGG + Intronic
1030600747 7:111589023-111589045 GACTTTGGAAGGATGGGGGTGGG + Intergenic
1031517921 7:122724028-122724050 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1032075047 7:128832193-128832215 TATTGGGGCAGGAGGGGGTAAGG - Intronic
1032465669 7:132143093-132143115 AACTGTGGAAGAAGGGGGTGGGG + Intronic
1032958269 7:136999538-136999560 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1032977214 7:137239541-137239563 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1032977747 7:137244521-137244543 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1033038665 7:137898913-137898935 AAATGTGGAAGGAGGGAGGGAGG + Intronic
1033219912 7:139521031-139521053 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1033441436 7:141383359-141383381 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1033712782 7:143966186-143966208 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1034313126 7:150107687-150107709 TACCGGGGAAGGAGGAGGTAGGG + Intergenic
1034477450 7:151294042-151294064 TACTGAGGAAGGATTGGGTAGGG + Intergenic
1034630499 7:152526814-152526836 AACTGTGGAAAGAGGGTGGAGGG + Intergenic
1034793736 7:153992980-153993002 TACCGGGGAAGGAGGAGGTAGGG - Intronic
1035233679 7:157483283-157483305 TTCTGTGGGGGGAGCGGGGAGGG - Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035493872 7:159304361-159304383 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1035895183 8:3392106-3392128 TGCGGTGGGGGGAGGGGGGAGGG + Intronic
1035948350 8:3990777-3990799 TCATGAGGAAGGAGAGGGGAGGG + Intronic
1036095828 8:5724731-5724753 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1037018343 8:13936852-13936874 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1037056583 8:14449593-14449615 TACTGTGGAGGGACGATGGAGGG - Intronic
1037140291 8:15511234-15511256 TCCAGTAGAAGGAGGGAGGAAGG + Intronic
1037179438 8:15987074-15987096 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1037831783 8:22194176-22194198 TACTGAGGAAGGCGGCGGGCGGG + Intronic
1038051465 8:23817826-23817848 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1038126930 8:24685119-24685141 GACTGTGGGGGGTGGGGGGAGGG + Intergenic
1038444230 8:27592507-27592529 TAACGTGGAAGGATGGGGAACGG + Intergenic
1038571659 8:28667712-28667734 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1038925938 8:32139376-32139398 GACTGTGCAAGGAGAAGGGATGG - Intronic
1039057477 8:33548317-33548339 TACTCCGGAAGGAGTGGGAAGGG + Exonic
1039425933 8:37485940-37485962 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1039610083 8:38912839-38912861 GAATGTGGGAGGTGGGGGGAAGG - Intronic
1039929444 8:41971073-41971095 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1040067018 8:43154335-43154357 TGCGGTGGGGGGAGGGGGGAGGG - Intronic
1040362195 8:46676899-46676921 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1040461659 8:47654867-47654889 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1040703848 8:50101699-50101721 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1040827725 8:51642206-51642228 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1041231799 8:55759908-55759930 CAGTGTGGAAGGAAGGGGCAGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041460215 8:58103313-58103335 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1041513748 8:58677232-58677254 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1041881833 8:62760626-62760648 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1041960926 8:63615181-63615203 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1042010301 8:64236697-64236719 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1042171196 8:65992994-65993016 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1042270322 8:66949245-66949267 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1042278553 8:67030077-67030099 TACTGGGGAAAGAGGAGAGATGG + Intronic
1042504640 8:69547167-69547189 TACTGTGGCAGGAGGAGGTGGGG + Intronic
1042720932 8:71826245-71826267 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1043017195 8:74954177-74954199 TCCTTTGGGGGGAGGGGGGAGGG - Intergenic
1043038664 8:75230965-75230987 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1043488673 8:80725176-80725198 TACTGTGGTAGGAGGGCAGAAGG + Intronic
1044203678 8:89466482-89466504 CCCTGTGGAAGGAGCAGGGAAGG - Intergenic
1044855606 8:96472384-96472406 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1045378277 8:101597680-101597702 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1045415848 8:101966482-101966504 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1045593923 8:103631297-103631319 TACAGTGTAAGGAAGGGGTAAGG + Intronic
1045957450 8:107925545-107925567 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1046159769 8:110345650-110345672 TAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1046368569 8:113270825-113270847 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1046390566 8:113567431-113567453 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1046424584 8:114030295-114030317 TGGGGTGGAGGGAGGGGGGAAGG - Intergenic
1046555286 8:115766877-115766899 CACTGTGGAATGAGAGGGAAGGG - Intronic
1046826668 8:118699478-118699500 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1046886981 8:119377762-119377784 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1047031667 8:120888312-120888334 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1047044857 8:121041099-121041121 TAGGGTGGGGGGAGGGGGGAAGG - Intergenic
1047077861 8:121423875-121423897 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1047567650 8:126062972-126062994 TGATGTGGAAGGAGGAGGCATGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047846123 8:128807217-128807239 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1047890432 8:129302924-129302946 TGCTGTGGAAGATGGGGGGATGG + Intergenic
1048795584 8:138146347-138146369 TGCTGTGGAAGAAGGGGAGGTGG - Intronic
1048818307 8:138355001-138355023 TAGGGTGGGAGGAAGGGGGAGGG - Intronic
1048877820 8:138850812-138850834 AACTGTGGATGGAAAGGGGAGGG - Intronic
1049875267 8:145013975-145013997 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1050895684 9:10883967-10883989 TACTGTGGATGGATGGAGCAGGG + Intergenic
1050956255 9:11665402-11665424 TAGGGTGGCAGGAAGGGGGAGGG - Intergenic
1050982341 9:12036208-12036230 TACTGAGGAAGGAAGGGTCAGGG - Intergenic
1051090539 9:13402721-13402743 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1051455802 9:17257117-17257139 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1051538094 9:18182138-18182160 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1051567528 9:18517559-18517581 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1051801528 9:20939893-20939915 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1051819151 9:21144192-21144214 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1052056189 9:23910380-23910402 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1052154804 9:25172569-25172591 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1052617270 9:30857016-30857038 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG + Intronic
1053726049 9:41002440-41002462 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1054331401 9:63760099-63760121 TATGGTGGGGGGAGGGGGGAGGG + Intergenic
1054596946 9:67077039-67077061 AACGATGGAAGGAGAGGGGAAGG - Intergenic
1054808177 9:69412688-69412710 AACTGAGGATGGAGGGGGAAGGG + Intergenic
1055350185 9:75378562-75378584 GAGGGTGGCAGGAGGGGGGAGGG + Intergenic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1055808395 9:80122173-80122195 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
1056096960 9:83264802-83264824 AATTGTGGGGGGAGGGGGGAAGG + Intronic
1056155187 9:83827463-83827485 TACTGTGGGAGTATGGAGGAAGG - Intronic
1056355298 9:85795646-85795668 TACTGTGGGAGTATGGAGGAAGG + Intergenic
1056737697 9:89223930-89223952 CACTGTGGAGGGAGGGAGGGAGG - Intergenic
1056910214 9:90692543-90692565 TCGGGTGGGAGGAGGGGGGAGGG + Intergenic
1057389313 9:94629642-94629664 TCCTGGGGAGGTAGGGGGGAGGG + Intronic
1057819566 9:98320828-98320850 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1057844727 9:98514649-98514671 TAGGGTGGGGGGAGGGGGGAGGG + Intronic
1058204861 9:102091648-102091670 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1058296239 9:103311689-103311711 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1058327475 9:103716523-103716545 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1058568978 9:106320147-106320169 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1058927916 9:109686818-109686840 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1058972794 9:110098144-110098166 GACAGTGGAAAGAGGGGAGAGGG + Intronic
1058989345 9:110240178-110240200 TACTGTGAAAGGGATGGGGAGGG - Intergenic
1059916256 9:119105114-119105136 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1060029691 9:120203602-120203624 TACTGATGAAGGAGGGAGGAGGG - Intergenic
1060149032 9:121275610-121275632 TACTGTGGTGGGAGGGGAGGTGG - Intronic
1060149206 9:121276792-121276814 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1060672403 9:125481330-125481352 CACTGGGGAATGAGCGGGGATGG + Intronic
1060734122 9:126055551-126055573 TGCTTTAGAGGGAGGGGGGAGGG - Intergenic
1060824338 9:126679388-126679410 GAGGGTGGATGGAGGGGGGATGG + Intronic
1061203579 9:129150656-129150678 CACTGTGGTGGGAGTGGGGACGG + Intergenic
1061427308 9:130507339-130507361 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1061509482 9:131051798-131051820 CACTGGGAAAGGAGGAGGGAGGG + Intronic
1061509490 9:131051821-131051843 TACTGGGAAAGGAGGAGGGAGGG + Intronic
1202804199 9_KI270720v1_random:35196-35218 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1203741662 Un_GL000218v1:8878-8900 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
1203411271 Un_KI270579v1:7690-7712 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1203701848 Un_KI270742v1:3467-3489 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
1203711389 Un_KI270742v1:101130-101152 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1203582800 Un_KI270746v1:27910-27932 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1185523803 X:761431-761453 GACTGTGGAAGGATGAGGGGTGG - Intergenic
1185660206 X:1721811-1721833 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1185660768 X:1727179-1727201 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1186230809 X:7451638-7451660 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1186280389 X:7986796-7986818 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1186473431 X:9838514-9838536 TACTAAGGAAGGAGGGGTTATGG + Intronic
1186582999 X:10840905-10840927 TAATGTGGAAGTGGTGGGGAGGG + Intergenic
1186642263 X:11468374-11468396 TACTGTGAAATGAAGGGGCAGGG - Intronic
1186652120 X:11572329-11572351 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1186726257 X:12362347-12362369 TGGAGTGGGAGGAGGGGGGAGGG - Intronic
1186775273 X:12858439-12858461 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1186786705 X:12962584-12962606 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1187024210 X:15417057-15417079 TACTGGGGGTGGAGGGGGGCGGG - Intronic
1187307634 X:18110754-18110776 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1187389837 X:18878760-18878782 CACTGGGGAAGGAGCAGGGATGG + Intergenic
1188000981 X:24981348-24981370 TATTGGGGCTGGAGGGGGGAAGG - Intronic
1188253415 X:27928216-27928238 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1188268025 X:28102635-28102657 TAGTGTGGGAGGCGGGGAGAGGG - Intergenic
1188341582 X:29008817-29008839 TATTGTGGGGGGAGGGAGGAAGG - Intronic
1188440532 X:30211406-30211428 GACTGTCGGGGGAGGGGGGAAGG + Intergenic
1188605484 X:32023930-32023952 TACAGAGGAAGGAGGGAGGAAGG + Intronic
1189043151 X:37563967-37563989 TGCGGTGGGGGGAGGGGGGAGGG + Intronic
1189071725 X:37870675-37870697 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1189225154 X:39406684-39406706 CCCTGTGGAAGGAGAGGGGAAGG - Intergenic
1189314148 X:40041912-40041934 TCCTGTGGAAGGAGAGGAGAAGG + Intergenic
1189525409 X:41814591-41814613 TTGGGTGGAGGGAGGGGGGAGGG + Intronic
1189564363 X:42225702-42225724 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1189590107 X:42501977-42501999 TCCTGTGGAAAGAGAGAGGAAGG + Intergenic
1189627145 X:42910618-42910640 TGGAGTGGGAGGAGGGGGGAGGG + Intergenic
1190518408 X:51249127-51249149 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1190555407 X:51629103-51629125 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1190824258 X:54002511-54002533 TAATGTAGAAGGAGGGGACATGG - Intronic
1190892206 X:54580139-54580161 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1190904809 X:54716519-54716541 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1191018374 X:55834757-55834779 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1191029041 X:55947487-55947509 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1191047755 X:56157235-56157257 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1191066353 X:56352321-56352343 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1191069161 X:56381149-56381171 TACTGTGGAAAGAGAGGGAGAGG + Intergenic
1191076118 X:56455341-56455363 TAGCGTGGGGGGAGGGGGGAGGG - Intergenic
1191114281 X:56835805-56835827 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1191195510 X:57717923-57717945 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1191271480 X:58477948-58477970 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1191707424 X:64108870-64108892 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1191751123 X:64543955-64543977 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1191983192 X:66948655-66948677 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1191984129 X:66960242-66960264 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1192086257 X:68100547-68100569 TACAGTTGAAGGAGGGGTGATGG + Intronic
1192182798 X:68926872-68926894 TACTGTTGGAGGAGGAGGGAGGG + Intergenic
1192439134 X:71162000-71162022 TACAGGGGAAGGAGAGAGGAGGG + Intronic
1192697068 X:73428761-73428783 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1192715823 X:73641659-73641681 TGGTGTGGGGGGAGGGGGGAAGG - Intronic
1192789322 X:74365821-74365843 TACTTTGTAAGGGGGTGGGATGG - Intergenic
1192801964 X:74474620-74474642 TGGGGTGGGAGGAGGGGGGAAGG - Intronic
1192900959 X:75495781-75495803 TACGGTGGGGGGAGGGGGGAGGG + Intronic
1192920258 X:75698580-75698602 TGAGGTGGGAGGAGGGGGGAAGG + Intergenic
1192945368 X:75961330-75961352 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1192946735 X:75971084-75971106 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1192956376 X:76074667-76074689 TGCGGTGGGGGGAGGGGGGAGGG + Intergenic
1193050587 X:77095251-77095273 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1193053308 X:77124289-77124311 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1193095539 X:77544558-77544580 TGGGGTGGAGGGAGGGGGGAGGG - Intronic
1193171023 X:78335902-78335924 GACTGTGGAGGGTGGGAGGAGGG - Intergenic
1193203498 X:78720174-78720196 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1193296764 X:79842513-79842535 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1193362031 X:80590401-80590423 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1193414407 X:81204034-81204056 TACAGAGGAGGGAGGGAGGAAGG - Intronic
1193449834 X:81652044-81652066 GAGTGTGGAAGGTGGGAGGAGGG + Intergenic
1193452589 X:81688985-81689007 TGCAGTGGAGGGAGGGGGGAAGG - Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193595808 X:83443779-83443801 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1193614748 X:83673407-83673429 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1193644343 X:84048386-84048408 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1193668641 X:84355709-84355731 TGGGGTGGGAGGAGGGGGGAGGG + Intronic
1193875212 X:86854479-86854501 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1193893343 X:87079735-87079757 TAGGGTGGGAGGAGGGGGGGAGG - Intergenic
1193969408 X:88033337-88033359 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1194064741 X:89247763-89247785 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1194380970 X:93191234-93191256 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1194622515 X:96190502-96190524 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1194629131 X:96261714-96261736 TGTTGTGGGGGGAGGGGGGAGGG + Intergenic
1195202318 X:102563772-102563794 AACTTTGGATGGAGGGTGGATGG + Intergenic
1195368311 X:104148301-104148323 TAGGGTGGGAGGAGGGGGGAGGG + Intronic
1195420346 X:104668467-104668489 TGCGGTGGGGGGAGGGGGGAGGG - Intronic
1195462536 X:105143839-105143861 TAGGGTGGAGGGAGAGGGGAGGG + Intronic
1195991025 X:110682429-110682451 GACTGAGGAAAGAGGAGGGAGGG - Intronic
1196003978 X:110815795-110815817 TACTGTGGAAGCAAAGAGGAGGG + Intergenic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196186443 X:112749558-112749580 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1196663101 X:118289080-118289102 TGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1197247285 X:124179316-124179338 TGGGGTGGGAGGAGGGGGGAGGG - Intronic
1197915549 X:131530469-131530491 TGGGGTGGAGGGAGGGGGGAAGG + Intergenic
1198128919 X:133674706-133674728 AACTGTGGGAGAAGGAGGGAGGG - Intronic
1198172712 X:134123169-134123191 TAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1198273868 X:135082686-135082708 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1198406654 X:136319451-136319473 TACTGTGGAAGAACGAGGCATGG + Intronic
1198525077 X:137492650-137492672 GGCTGTGGAAGGAAGGGGGAAGG + Intergenic
1198543455 X:137665693-137665715 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199565851 X:149215194-149215216 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1199837893 X:151611959-151611981 TAGGGTGGGGGGAGGGGGGAGGG - Intronic
1200002078 X:153067326-153067348 TTTTGTGGAAAGAGGGGTGACGG - Intergenic
1200005655 X:153082699-153082721 TTTTGTGGAAAGAGGGGTGACGG + Intergenic
1200246853 X:154531069-154531091 TATTTAGGAAGGAGAGGGGATGG - Intergenic
1200286326 X:154825920-154825942 TGGGGTGGAGGGAGGGGGGAGGG + Intronic
1200431503 Y:3088326-3088348 GACGGTGGAAGGGGGAGGGAGGG - Intergenic
1200589618 Y:5053915-5053937 TGGGGTGGGAGGAGGGGGGAAGG + Intronic
1200678398 Y:6178062-6178084 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1200809993 Y:7474327-7474349 TGCGGTGGGGGGAGGGGGGAGGG - Intergenic
1201056244 Y:9994947-9994969 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1201071733 Y:10153108-10153130 TGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1201155188 Y:11126332-11126354 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
1201171250 Y:11268142-11268164 TGCAGTGGGGGGAGGGGGGAAGG - Intergenic
1201234665 Y:11897539-11897561 CACTGTGGGAGGAGAGGGCATGG - Intergenic
1201394150 Y:13529893-13529915 TGGTGTGGGCGGAGGGGGGAGGG + Intergenic
1201544919 Y:15151142-15151164 TGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1201677096 Y:16598263-16598285 TAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1201701874 Y:16891788-16891810 TGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1201745286 Y:17365485-17365507 TGGGGTGGCAGGAGGGGGGAGGG + Intergenic
1201928077 Y:19311870-19311892 TGGAGTGGGAGGAGGGGGGAGGG - Intergenic
1202052184 Y:20792710-20792732 TGGCGTGGGAGGAGGGGGGAGGG - Intergenic
1202366707 Y:24170758-24170780 TGCTGTGGGAGGAGGTTGGAGGG - Intergenic
1202373698 Y:24214724-24214746 TGCTGTGGGAGGAGGTTGGAGGG + Intergenic
1202497083 Y:25455396-25455418 TGCTGTGGGAGGAGGTTGGAGGG - Intergenic
1202504075 Y:25499365-25499387 TGCTGTGGGAGGAGGTTGGAGGG + Intergenic
1202591793 Y:26492914-26492936 TGCAGTGGGGGGAGGGGGGAGGG - Intergenic