ID: 1139378684

View in Genome Browser
Species Human (GRCh38)
Location 16:66516689-66516711
Sequence CATGAGCACCGCCTCCGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139378682_1139378684 -1 Left 1139378682 16:66516667-66516689 CCAGTGGGCAAACACCACTAAGC 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1139378684 16:66516689-66516711 CATGAGCACCGCCTCCGTGCCGG 0: 1
1: 0
2: 2
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139378684 Original CRISPR CATGAGCACCGCCTCCGTGC CGG Intronic
901753605 1:11427452-11427474 CATGAGCACCTGCTATGTGCAGG + Intergenic
902515433 1:16987195-16987217 CATGAGCACTGCCACTGTGGTGG + Exonic
906143607 1:43547517-43547539 CCTGAGCCCTGCCTCAGTGCAGG - Intronic
917835899 1:178941495-178941517 CATGCTCTCCGCCTCCATGCGGG + Intergenic
920191113 1:204194485-204194507 CTTGAGCACCGACTAGGTGCTGG + Intronic
924588779 1:245383379-245383401 CCTGAACACAGCCTTCGTGCAGG + Intronic
1066080805 10:31928850-31928872 CGTGAGCCCCGCCCCCGCGCCGG - Intronic
1067342674 10:45418116-45418138 TCTGAGCACCGCCTCTGTGCTGG + Intronic
1073426063 10:103456367-103456389 AATGAGCACCTCCTCTGTGTCGG + Intronic
1074449369 10:113546689-113546711 CTTGAGCACCGACTGTGTGCTGG + Intergenic
1074629761 10:115239511-115239533 CATGAGCACCGCGCCCGGCCGGG + Intronic
1076259707 10:129055577-129055599 CAGGAGCACCTACTCTGTGCTGG - Intergenic
1076443247 10:130494987-130495009 CTTGAGCACCTCCTAGGTGCTGG + Intergenic
1076735716 10:132458062-132458084 CACGAGCACGGCCTCCTTGGAGG - Intergenic
1076906908 10:133366993-133367015 CATGACCAGCCCCTCCCTGCAGG - Exonic
1077217834 11:1402459-1402481 CCTGAGCCCCGCCTCCGGGGAGG + Intronic
1078927131 11:15885127-15885149 TCTGAGCAGCGCCTCTGTGCTGG + Intergenic
1083680517 11:64349601-64349623 CATCAGCGCCTCCTCCTTGCTGG - Exonic
1084452799 11:69250080-69250102 CATGCGGACCGACCCCGTGCGGG - Intergenic
1086064655 11:82732887-82732909 CAAGACTGCCGCCTCCGTGCCGG + Exonic
1088715996 11:112550403-112550425 CATGTGCACCTCCTCCTTTCTGG + Intergenic
1089291819 11:117441834-117441856 CATGAAGACGGCCTCCATGCGGG + Intronic
1089781656 11:120877346-120877368 CATGAGCACTCTCTCTGTGCAGG - Intronic
1090408081 11:126489313-126489335 GTTGAGCACCTGCTCCGTGCAGG - Intronic
1090939875 11:131377838-131377860 CATGATCACCACCACCGTGATGG - Intronic
1091703974 12:2681322-2681344 CATGAGCACCGACTGTGTGCTGG - Intronic
1091710646 12:2737798-2737820 CATGAGCACTGACTGTGTGCTGG - Intergenic
1091713496 12:2759858-2759880 CATGAGCACTGACTGGGTGCTGG - Intergenic
1092482152 12:8869331-8869353 CATGAGTTCTGCCTCCATGCTGG + Intronic
1104691007 12:130826402-130826424 CAGGAGCACCGCCTCCTTGCAGG - Intronic
1113753428 13:112791943-112791965 CAGGAGCGCCGTCTGCGTGCAGG + Intronic
1113901759 13:113801773-113801795 CATCATCACCGCCGCCGTCCTGG + Exonic
1114614057 14:24059113-24059135 TCTGAGCCCCGCCTCCCTGCAGG + Exonic
1119667484 14:76495473-76495495 CATGCTCAACCCCTCCGTGCTGG - Intronic
1121457128 14:94045610-94045632 CATGGTCACAGCCTCTGTGCTGG - Intronic
1122932688 14:104941941-104941963 CATGAGCATTCCCTCCATGCAGG - Exonic
1122934890 14:104951346-104951368 CATGAGCCTCCCCTCCATGCAGG - Exonic
1123101499 14:105804970-105804992 CATGACCACCACCACCGTGGGGG + Intergenic
1127299937 15:57643235-57643257 CACCAGCACCCGCTCCGTGCTGG + Intronic
1128521872 15:68380687-68380709 CATGAGCGCCGGCACCATGCGGG - Intronic
1130868812 15:87953914-87953936 CATCTGCCCCTCCTCCGTGCGGG + Intronic
1130924199 15:88373071-88373093 CATGAGAACTGCCTCAGTGGTGG - Intergenic
1132802989 16:1763315-1763337 CATGACCAGCGACTCCCTGCTGG - Intronic
1132855616 16:2043354-2043376 GCTGAGCACCTGCTCCGTGCAGG - Intronic
1138440442 16:57031397-57031419 GATGAGGTCCGCCTCCCTGCAGG - Exonic
1139378684 16:66516689-66516711 CATGAGCACCGCCTCCGTGCCGG + Intronic
1139902364 16:70338205-70338227 CATGAGCACCTCCACCACGCCGG - Intronic
1142127157 16:88415853-88415875 TATGAGCACCGACTGTGTGCCGG - Intergenic
1145932865 17:28698429-28698451 CCTGACCACCGCTTCAGTGCGGG - Intronic
1145963812 17:28902927-28902949 CAGCAGCAGCGCCTCCATGCCGG + Exonic
1148156825 17:45429548-45429570 CTTGCGCCCCGGCTCCGTGCGGG + Intronic
1152420824 17:80192112-80192134 AATGAGCACAGCCTGCGTGTTGG - Intronic
1155077605 18:22374313-22374335 TATGCGCACAGCCTCAGTGCTGG - Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159915130 18:74182015-74182037 CATGAGGTCAGCCTCCCTGCAGG - Intergenic
1162301541 19:9847752-9847774 CATGAGCCCTGCCACCCTGCAGG - Intronic
1163612629 19:18309176-18309198 CATGGGCACTGCCTGTGTGCTGG - Intronic
1165845142 19:38813141-38813163 CATGAGCACTTCCTCTTTGCAGG - Exonic
925284174 2:2705211-2705233 CCTCAGCACCGGCTCAGTGCAGG + Intergenic
925556075 2:5132856-5132878 CACGAGCACAGTCTCAGTGCAGG - Intergenic
927990224 2:27442335-27442357 CCTGGGCCCCGCCTCCGTCCCGG - Intergenic
935627995 2:105186776-105186798 CATGTGCACCTGCTCTGTGCTGG + Intergenic
937941120 2:127286805-127286827 CATTAGCACCTACTCCATGCTGG - Exonic
946327673 2:218993155-218993177 CATGAGCAGCGCCCCCGCGCCGG - Exonic
948362164 2:237429925-237429947 CATGGGCCCCGCCTCCTGGCTGG - Intergenic
1168880861 20:1204893-1204915 CCTCATCACCACCTCCGTGCTGG + Intronic
1173307120 20:41861525-41861547 CAGGAGCGCAGCCTCCCTGCAGG + Intergenic
1175704418 20:61165624-61165646 CATGACCACAGCCTCCTTCCTGG - Intergenic
1175768280 20:61606249-61606271 GATAAGCACCACCTCTGTGCCGG + Intronic
1176145728 20:63564604-63564626 CATGGGCACTGGCTCCCTGCCGG + Exonic
1176150911 20:63590292-63590314 CCTGAGCACGGCCGCCGTGCAGG - Exonic
1179440553 21:41390644-41390666 CATGCTCAGCGCCTCCGTGGTGG - Exonic
1180101797 21:45590918-45590940 CCTGAGCACCGCCCGGGTGCAGG + Intergenic
1180625277 22:17190090-17190112 CCAGAGCACACCCTCCGTGCAGG + Intronic
1181766331 22:25094801-25094823 CATGAGCACAGCCTGTGTCCTGG + Intronic
1182978599 22:34646830-34646852 GATGAGCACAGCCTCCATCCTGG + Intergenic
1184859228 22:47163738-47163760 CATGAGCCCCGGCTGCATGCAGG - Intronic
1184989093 22:48155181-48155203 CTTGAGCACCGACCACGTGCTGG + Intergenic
1185031351 22:48444870-48444892 CCTGAGCACCTGCTCTGTGCTGG + Intergenic
950618128 3:14178636-14178658 CAAGCGCACCGCCTCGGGGCGGG - Exonic
955221962 3:57030298-57030320 GTTGAGCACCTCCTCCTTGCCGG - Intronic
961831485 3:129625266-129625288 CATGAGGACTGCCTACCTGCTGG + Intergenic
963250312 3:143096467-143096489 CATGGGTACCGGCTCCCTGCAGG - Intergenic
969622117 4:8283886-8283908 CTCCAGCACCGCCTCCCTGCTGG + Intronic
987147530 5:15006761-15006783 CTTGAGCACCTCCTAAGTGCTGG - Intergenic
998169001 5:139861180-139861202 CATGAGCTCAGCATGCGTGCAGG + Intronic
999197348 5:149791477-149791499 CATGAGCTCCCCATCCCTGCAGG + Intronic
1001086487 5:168703416-168703438 CCTGAGCTCCGCCTCCTTTCAGG + Intronic
1001493318 5:172170815-172170837 CATGGGCTCTGCCTCCTTGCAGG + Intronic
1001707005 5:173748732-173748754 CAGTAGCACAGCCTCCCTGCAGG + Intergenic
1003463437 6:6353530-6353552 CATGAACACAGACTGCGTGCTGG - Intergenic
1006805717 6:36787819-36787841 CATGACCACCGCCACCATCCTGG + Intronic
1008044656 6:46839163-46839185 CAGCAGCACCTCCTCCATGCAGG + Exonic
1008587578 6:52963250-52963272 CATTAGAACCGCCACTGTGCTGG + Intergenic
1014311899 6:119814164-119814186 CATGACCACTGTCTCCTTGCGGG + Intergenic
1030395814 7:108985230-108985252 CTTGAGCACAGCTTCCCTGCAGG - Intergenic
1042178479 8:66060826-66060848 ATTGAGCACCGCCTCTGTGTTGG + Intronic
1043391610 8:79797467-79797489 CATGAGCACCGCACCCCTCCTGG - Intergenic
1045418104 8:101986923-101986945 CATCAGCAGCACCTCCCTGCTGG - Intronic
1049105468 8:140609719-140609741 CTTGAGCACCTGCTCTGTGCTGG - Intronic
1049693074 8:143971265-143971287 CCAGAGCACCTCCTCAGTGCAGG + Intronic
1052791634 9:32880237-32880259 CATGAGCACTGCCTGCGTGCGGG - Intergenic
1053652937 9:40187743-40187765 CAGCAGCACCTCCTCCATGCAGG - Intergenic
1053903342 9:42817051-42817073 CAGCAGCACCTCCTCCATGCAGG - Intergenic
1054531646 9:66188478-66188500 CAGCAGCACCTCCTCCATGCAGG + Intergenic
1058877863 9:109259781-109259803 AAAGAGCACAGCCTCCCTGCAGG + Intronic
1059391201 9:114000735-114000757 CAAGACCAGCCCCTCCGTGCAGG - Intronic
1059992042 9:119874809-119874831 CATGAGCACCAACCCTGTGCTGG + Intergenic
1060143480 9:121230992-121231014 CATGAGCACCTACTACGTGCAGG + Intronic
1062419917 9:136475552-136475574 CATGTGCACAGCTTCCGTGGTGG + Exonic
1203793642 EBV:164534-164556 CAAGAGCGCCGCCTTCGTGCTGG - Intergenic
1189974528 X:46447921-46447943 CATGAGCCCGTTCTCCGTGCTGG - Intronic
1192818026 X:74614553-74614575 CCTGAGCAACGTCTCCGAGCAGG - Exonic
1200153085 X:153960922-153960944 CGTGGGCACAGCCTCTGTGCAGG + Intronic