ID: 1139380660

View in Genome Browser
Species Human (GRCh38)
Location 16:66528544-66528566
Sequence CAAGTTTGCTAGCATTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139380660 Original CRISPR CAAGTTTGCTAGCATTCCAT TGG (reversed) Intronic
902123633 1:14189708-14189730 CAAGTTTGCTGCTATCCCATTGG + Intergenic
902395077 1:16128163-16128185 CAAGTTTGATGGGATTGCATGGG - Intronic
905072999 1:35243999-35244021 CAAGTTTGCTACTGTCCCATTGG + Intergenic
907598235 1:55740245-55740267 AAAGTTTTCTCCCATTCCATAGG + Intergenic
909357216 1:74723634-74723656 CACTTTTGCTAACATTCCATTGG - Intronic
909865956 1:80671913-80671935 CCAGTTTGATATAATTCCATCGG + Intergenic
911900855 1:103501843-103501865 CATGTTTGCTAATAGTCCATAGG + Intergenic
913034506 1:114950128-114950150 CACTTTTGCTCACATTCCATTGG - Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916484756 1:165248888-165248910 CATGTCTGCTAATATTCCATGGG - Intronic
919701109 1:200631918-200631940 CACATTTGCTTTCATTCCATTGG + Intronic
920038511 1:203081317-203081339 ACAGTTTGCTAGAATTCCACAGG - Intergenic
920937679 1:210450717-210450739 CAAATTTGCTAGCATTCCAGGGG - Intronic
921021725 1:211241992-211242014 CACATCTGCTATCATTCCATTGG - Intergenic
924390333 1:243548358-243548380 CAAGTTTTCTAGCAATACTTTGG + Intronic
1064587531 10:16853485-16853507 CACGTTTGCTATCTATCCATTGG - Intronic
1064994697 10:21286374-21286396 CAATGTTGGTAGCATTTCATTGG - Intergenic
1067202227 10:44183119-44183141 CAATTTTGGCAGCATTACATTGG - Intergenic
1067330443 10:45311046-45311068 CAAGTTTCCAAGCATTTCCTTGG - Intronic
1069699297 10:70409643-70409665 CATATTAGCTAGCATTCCAGAGG - Intronic
1071469606 10:85974141-85974163 CACTTTTGCCAGCATGCCATTGG + Intronic
1072850242 10:98882613-98882635 CACTTCTGCTAACATTCCATTGG + Intronic
1074507332 10:114083104-114083126 CAAGCTTGCTGACATCCCATTGG + Intergenic
1075627717 10:123974490-123974512 CATGTTTGCTAACAGCCCATTGG - Intergenic
1075766391 10:124896370-124896392 GAAGTTTTCTAGCACTCAATTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1076506455 10:130976700-130976722 CAAGTTTTCTCCCATTCCATGGG + Intergenic
1078932749 11:15925237-15925259 CCATTTTGCTTGCATCCCATTGG - Intergenic
1079648563 11:22897225-22897247 CAAGTTTAGTAGCATTTCCTAGG + Intergenic
1082701664 11:56439762-56439784 AAAATTTGCCAGCATTCCAAGGG + Intergenic
1086331603 11:85760044-85760066 CACATTTGCTAACATTCCATTGG - Intronic
1086850954 11:91807515-91807537 TCAGTTTGCTAGCATTTTATTGG + Intergenic
1086892687 11:92276526-92276548 CACGAATGCTAACATTCCATTGG - Intergenic
1087274056 11:96142562-96142584 CCAGTTTGCTGACATTACATAGG + Intronic
1088108410 11:106230906-106230928 CAATTTTTCTGACATTCCATGGG - Intergenic
1088884174 11:113994246-113994268 AAAGTTTGCCAGTATCCCATAGG - Intergenic
1089799749 11:121016052-121016074 CAAGTTGGCAAGAGTTCCATGGG + Intergenic
1091557541 12:1586104-1586126 CATGTTTGCAAGCATTATATAGG - Intronic
1092088933 12:5788036-5788058 CACATTTGCTAGCATTCCATTGG - Intronic
1093047134 12:14459969-14459991 CAAGTTTGATTGAATTCCTTGGG - Intronic
1095660790 12:44732766-44732788 CATATTTTCTCGCATTCCATAGG - Intronic
1097324639 12:58262387-58262409 CACGTTTGCTTGCATTCACTTGG - Intergenic
1098537422 12:71609117-71609139 CAAGTTTCCTAGTATTTCATGGG + Intergenic
1099928715 12:89049473-89049495 CAAATTTGCTAGCGTGGCATGGG - Intergenic
1101415908 12:104507846-104507868 CATGTTTGCTGCCATCCCATTGG + Intronic
1102037165 12:109777742-109777764 CATGTCTGCTAACATCCCATTGG + Intergenic
1102090117 12:110179241-110179263 CTATTTTGGTAGCAGTCCATTGG - Intronic
1102741604 12:115212221-115212243 CAAGTTTGCTAGTATCCAACTGG - Intergenic
1112146369 13:96704857-96704879 CAAGTTGCCTGGGATTCCATAGG + Intronic
1115287308 14:31729436-31729458 CAAGTTTAATAGTATTCCAAAGG + Intronic
1117486286 14:56200926-56200948 CAAGTTTGTTTGGATTTCATAGG + Intronic
1117658300 14:57978940-57978962 CAAGGTTGCTACCATACAATGGG + Intronic
1121000440 14:90448298-90448320 CATGTTTGTTAACATCCCATTGG - Intergenic
1129178743 15:73858278-73858300 CATGTCTGCTAGTATCCCATTGG - Intergenic
1129971892 15:79785848-79785870 TAAATTTTCTACCATTCCATAGG - Intergenic
1130713585 15:86309822-86309844 TTTGTTTGCTAGTATTCCATTGG + Intronic
1131292338 15:91117674-91117696 CATGTTTGCTAGCATTTCATTGG + Intronic
1139380660 16:66528544-66528566 CAAGTTTGCTAGCATTCCATTGG - Intronic
1140978200 16:80081116-80081138 CATGTCTGCTAGGATTACATGGG - Intergenic
1141059148 16:80849006-80849028 CAAGTCTGCTAGCCTTCCTTTGG + Intergenic
1141819619 16:86436129-86436151 TCAGTTTGCTAGCATGCCAATGG + Intergenic
1144913633 17:18703868-18703890 CACTTCTGCTTGCATTCCATTGG + Intronic
1145276080 17:21431624-21431646 AATGTTTGGTAGCATTCAATAGG + Intergenic
1145408763 17:22636667-22636689 AAAATTTGCTAGCATTCTGTAGG - Intergenic
1145712368 17:26989515-26989537 AATGTTTGGTAGCATTCAATAGG + Intergenic
1151905414 17:77045205-77045227 CACGTCTGCTAACATTTCATTGG - Intergenic
1155749465 18:29402713-29402735 CTAGTTTGTTAGCATCCCATAGG + Intergenic
1156165657 18:34417597-34417619 CAAGTGTGCTATCACTGCATTGG - Intergenic
1157105827 18:44773373-44773395 CAAGCTTGCTATGATTCCTTTGG - Intronic
1158811576 18:61043717-61043739 AAAGTTTTCTCCCATTCCATGGG - Intergenic
1159765919 18:72488198-72488220 AAAGATTGCTAACAGTCCATTGG - Intergenic
1161341224 19:3743729-3743751 CAATTCTGCTAGTGTTCCATTGG + Intronic
1161909179 19:7179916-7179938 CACGTTTGCAAATATTCCATTGG - Intronic
932183175 2:69668015-69668037 CATGTCTGATAACATTCCATTGG + Intronic
936699597 2:114995037-114995059 CACGTTTGCTAACATCCCACTGG - Intronic
941505184 2:166335282-166335304 CAAGTTTGCAATCCTTTCATTGG - Intronic
943632436 2:190269298-190269320 AAAGTTTTCTCTCATTCCATAGG - Intronic
945510368 2:210694111-210694133 TATGTTTGCTAGCATCCCATTGG + Intergenic
947044179 2:225959711-225959733 AAATATTGCTAACATTCCATGGG + Intergenic
948064463 2:235066850-235066872 CAATTTAGCAAGCTTTCCATCGG + Intergenic
1170049928 20:12130774-12130796 CAAATTTGTTACCATTCCATTGG - Intergenic
1172381698 20:34498922-34498944 AATGTTTGTTAGAATTCCATTGG + Intronic
1173010796 20:39179868-39179890 CAAATTTTCTCCCATTCCATAGG - Intergenic
1173031095 20:39360823-39360845 CAAGTTTGCTAACATCGTATTGG - Intergenic
1177005538 21:15668032-15668054 CTAGCAGGCTAGCATTCCATAGG - Intergenic
1182751992 22:32649153-32649175 CACGTTTGCTACCAGCCCATTGG - Intronic
1184969111 22:48002723-48002745 CAAGTTTTTGAGCATTTCATGGG + Intergenic
951585277 3:24208907-24208929 AAAATTTTCTACCATTCCATAGG - Intronic
952181631 3:30922604-30922626 CAAATTTGCTATTGTTCCATTGG + Intergenic
952201608 3:31134736-31134758 CATGCTTGCTAGTATTCCACTGG + Intergenic
952380463 3:32800612-32800634 CATGTTTGCTATTGTTCCATTGG + Intergenic
953368240 3:42365592-42365614 CCTGTTTGCTAACATCCCATTGG + Intergenic
957320687 3:78626264-78626286 CAATTTTCGTAACATTCCATGGG + Intronic
958467542 3:94476081-94476103 CACATTTGCTAACATTCCATTGG + Intergenic
962984811 3:140525675-140525697 TCAGTTTGCTAGTATTTCATTGG - Intronic
963316637 3:143765842-143765864 CAAGTCTGCTAACATCCTATTGG - Intronic
963510562 3:146242662-146242684 GAAGTTGGCTAGAATTCCAGAGG - Intronic
966770227 3:183497578-183497600 CAATTTTGCTCACATTCCATTGG - Intronic
970638734 4:18039621-18039643 CACATTAGCTAACATTCCATTGG + Intergenic
971216267 4:24665052-24665074 TGTGTCTGCTAGCATTCCATTGG + Intergenic
973086789 4:46073671-46073693 CAAGATTGCAGGCATTCAATGGG - Intronic
973269743 4:48250498-48250520 CAAGTTTGCTACTGTCCCATTGG - Intronic
978892653 4:113848468-113848490 CACATTTGTTAACATTCCATTGG + Intergenic
978930290 4:114302586-114302608 CAACTTCCCTAGCATTCCAAGGG - Intergenic
979396066 4:120190885-120190907 GAAGTTTGCTACTAGTCCATGGG + Intergenic
980196447 4:129595042-129595064 AATGTTTTCTATCATTCCATAGG - Intergenic
981547287 4:145906859-145906881 CAAGTTTTCTTGCAGTCCAGAGG - Intronic
982439621 4:155420379-155420401 CAAATCTGTTAACATTCCATTGG - Intergenic
983135555 4:164075340-164075362 CATGTTTGCTAATATCCCATTGG - Intronic
985365265 4:189224714-189224736 CAAGTTAGCAAGCATTACAGAGG + Intergenic
986189678 5:5483621-5483643 CAACTTTGCTACCTTTCCACTGG - Intronic
986581121 5:9266737-9266759 CAAGTTGGCTAGAGTTTCATGGG - Intronic
987154455 5:15074857-15074879 CATGTCAGCTAACATTCCATTGG - Intergenic
992982987 5:82196307-82196329 CAAATTTTCTCCCATTCCATTGG + Intronic
995703311 5:114959292-114959314 CAAGTTTGCTAGCAGTAGAGAGG - Intergenic
997813295 5:136993107-136993129 CTATTTTGCTAGCCTTCCAGTGG + Intronic
1000816447 5:165928531-165928553 AAAGTGAACTAGCATTCCATGGG - Intergenic
1000921512 5:167143904-167143926 CCAGTTTGCCAGCATTTGATTGG - Intergenic
1005432021 6:25768411-25768433 AAAATTTGCTAGTGTTCCATAGG - Intronic
1008362587 6:50638991-50639013 CTATTTTGCCACCATTCCATTGG - Intergenic
1010329756 6:74609383-74609405 CAACTCTGCTAACATCCCATTGG + Intergenic
1011408941 6:87045726-87045748 CGTGTTTGCTAGCATCCCATTGG - Intergenic
1016876877 6:148874067-148874089 CAGGTGTGTTAGCATTCCACAGG + Intronic
1018748512 6:166781380-166781402 CAAGTTGGCTAGTCTTCCCTGGG - Intronic
1020688311 7:11323188-11323210 CATGTTTGCTAGAATTCCCAAGG - Intergenic
1022754861 7:33276832-33276854 CACCTTTGCAAGCAGTCCATAGG + Intronic
1023374576 7:39543243-39543265 CAAGTTTGTTAGCTTCCCTTGGG - Intergenic
1025753241 7:64311594-64311616 TAAGTTTACTATCCTTCCATTGG - Intronic
1027217258 7:76192004-76192026 CACATCTGCTTGCATTCCATGGG + Intergenic
1027844303 7:83352272-83352294 CAAATTTTCTACCATCCCATAGG + Intergenic
1029012494 7:97276996-97277018 CAAGTTTCCTAGAACTCCAGTGG + Intergenic
1031362441 7:120862745-120862767 AAAGTTTTCTAGGATTTCATAGG - Intergenic
1032612753 7:133433335-133433357 CATATTTGCTAACATTCCATTGG - Intronic
1033890058 7:146001084-146001106 CAAGTCTTCTAATATTCCATTGG + Intergenic
1041363382 8:57075017-57075039 AAAGTTTTCTCCCATTCCATAGG + Intergenic
1042691991 8:71510112-71510134 CATGTTTGCTAAAATTTCATTGG - Intronic
1043112695 8:76207935-76207957 TGAGTTTACTAGCAATCCATGGG - Intergenic
1044042041 8:87382210-87382232 CCAGTTAGCTAGAATTCCATAGG - Intronic
1044620133 8:94182369-94182391 TCAGTTTGCTAGTATTTCATTGG - Intronic
1046799751 8:118412924-118412946 CACATTTGCTAGCATTCCATTGG - Intronic
1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG + Intergenic
1050022320 9:1297199-1297221 GAAGTTTGCTCGTATACCATTGG - Intergenic
1050065882 9:1759138-1759160 CAAGTCGGCTAGCATCCTATTGG - Intergenic
1050272567 9:3961557-3961579 CAAGGTTGCCAACATTCAATAGG + Intronic
1050315640 9:4398186-4398208 CAATTTTGTGAGGATTCCATTGG - Intergenic
1050486934 9:6144078-6144100 CAAATCTGCTAACATCCCATTGG + Intergenic
1051245293 9:15104305-15104327 CAATTTTTCTAGCAGTTCATAGG - Intergenic
1051290625 9:15542063-15542085 CTAGTTTACTAGCATGCCACTGG + Intergenic
1051575374 9:18609385-18609407 CATGCTTGCTGGTATTCCATTGG + Intronic
1055200746 9:73657750-73657772 CAAGTTAGTTCACATTCCATAGG + Intergenic
1055678292 9:78688566-78688588 CATGTTTGCCAAGATTCCATTGG - Intergenic
1055857231 9:80703801-80703823 CATGTTTGTTAACATTCCATTGG + Intergenic
1055887410 9:81080176-81080198 CAAGATTGTTGGCATTCCAAAGG + Intergenic
1057362343 9:94385160-94385182 CAAATTTTCTCCCATTCCATAGG + Intronic
1059373020 9:113858531-113858553 CACATTTGCTAGCATCCCATTGG - Intergenic
1186021980 X:5266775-5266797 CAGTTTTGCTAGTATTACATAGG - Intergenic
1188994085 X:36860885-36860907 CAAGTAGCCAAGCATTCCATAGG + Intergenic
1189434623 X:40980888-40980910 CAAGTTTGAGAGCATTCCTGAGG - Intergenic
1189567981 X:42263438-42263460 TATGTTTGCTAACATACCATTGG + Intergenic
1195507305 X:105672682-105672704 CAAGTTGTCTAGCATGCCATTGG - Intronic