ID: 1139382496

View in Genome Browser
Species Human (GRCh38)
Location 16:66542297-66542319
Sequence CTTAACGAGAGCTTAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139382492_1139382496 -6 Left 1139382492 16:66542280-66542302 CCTAAGTGTCCTGCCTCCTTAAC 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 80
1139382488_1139382496 18 Left 1139382488 16:66542256-66542278 CCCCACAGACTATTAGATTTTAG 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 80
1139382491_1139382496 16 Left 1139382491 16:66542258-66542280 CCACAGACTATTAGATTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 80
1139382489_1139382496 17 Left 1139382489 16:66542257-66542279 CCCACAGACTATTAGATTTTAGG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 80
1139382487_1139382496 29 Left 1139382487 16:66542245-66542267 CCTTAGTTCAACCCCACAGACTA 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139382496 Original CRISPR CTTAACGAGAGCTTAATCAA TGG Intronic
901211735 1:7530262-7530284 CTTAACCAGAGCTTCATGAAAGG + Intronic
903699781 1:25238428-25238450 ATTAAGGAGAGCTTAATAAAGGG - Intergenic
905961194 1:42044043-42044065 CTCAATGAGATCTCAATCAAGGG + Intergenic
906984537 1:50669077-50669099 CTTAATGATAGATTAAACAAGGG - Intronic
911395813 1:97307921-97307943 CTTAAAGAGAGCTTCCACAAAGG - Intronic
918634132 1:186754806-186754828 TTTAAAGAGAGTTTAATAAAGGG + Intergenic
919310819 1:195905474-195905496 CTTACCTATAGTTTAATCAATGG - Intergenic
1063449143 10:6139990-6140012 CACAAGGAGAGCTTAATAAATGG - Intergenic
1064363999 10:14690759-14690781 TTCAAAGAGAGCTTAATAAAGGG - Intronic
1066981540 10:42420949-42420971 CTTAAACTGAGCTAAATCAAAGG - Intergenic
1070518886 10:77234516-77234538 CTAAACAAGAGCTAAATCATTGG + Intronic
1071993720 10:91126624-91126646 ATTAAAGAGAGTTTAATAAAAGG - Intergenic
1074687580 10:115974656-115974678 CTTAACAAGAAATTAGTCAAGGG - Intergenic
1076483206 10:130798330-130798352 CTCAGCGAGATCTCAATCAATGG + Intergenic
1085611553 11:77954876-77954898 CATAACAAGTGCTTAATAAATGG + Intronic
1088568026 11:111194269-111194291 CTTGAGGAGAGTTTAATGAAGGG + Intergenic
1088709820 11:112498246-112498268 CATAACAAGAGCTCAATAAATGG - Intergenic
1101411937 12:104476765-104476787 CTGGATGACAGCTTAATCAAAGG - Intronic
1101696333 12:107130707-107130729 CTTAATAAGAGCTAAATAAATGG - Intergenic
1101837640 12:108306366-108306388 ATTAACGAGAACTTAGTCAGGGG - Intronic
1103277885 12:119728514-119728536 CTGAACGAGAGCTCAAACAGAGG - Exonic
1104076403 12:125393650-125393672 CTCAAAGAGAACTTAATGAAGGG + Intronic
1106423975 13:29608118-29608140 CTTAAAGAGACCTCAACCAAAGG - Intergenic
1112762124 13:102703265-102703287 CTTTCCTAGAGCTTAGTCAATGG + Intergenic
1118048860 14:62004482-62004504 CTTAGAAAGATCTTAATCAAGGG + Intronic
1119672400 14:76529561-76529583 CATAACGAGGCTTTAATCAATGG + Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1127222368 15:56893289-56893311 GGTAACAAGAGCTTAATAAAGGG + Intronic
1139303253 16:65962780-65962802 CCTAACAAGAGCTCAATAAATGG + Intergenic
1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG + Intronic
1141185571 16:81784638-81784660 TTTAACAATAGCTTAATCTAAGG + Intronic
1144097271 17:11911729-11911751 CTTAAAGAAAGCTAAATAAATGG - Intronic
1144116074 17:12092337-12092359 CTTAAGGACAGCTTTATAAAGGG + Intronic
1164408308 19:27974655-27974677 CTTAAAGTGAACTAAATCAAAGG + Intergenic
1165182804 19:33987401-33987423 CTCAAGGAGAGTTTAATAAAGGG + Intergenic
1166438900 19:42793246-42793268 CTTAAAGAAAGCTTGCTCAAAGG - Intronic
1166487860 19:43229099-43229121 CTTAAAGAAAGCTTGCTCAAAGG - Intronic
928361885 2:30670069-30670091 CTTAAAGATAGGTCAATCAATGG - Intergenic
928832960 2:35510962-35510984 CTTAAGGATAGGTTCATCAAGGG - Intergenic
931197847 2:60069784-60069806 CTTAAGTGGAGCTTAACCAAAGG + Intergenic
939171651 2:138702945-138702967 CTTAATGAGAACTAAATCAAAGG + Intronic
940361207 2:152798118-152798140 TTTAAAGAGAGTTTATTCAAGGG + Intergenic
940938555 2:159528741-159528763 GTTAACTAGAGGTTAATAAAAGG - Intronic
941570903 2:167169140-167169162 TTTAACCAGAGCCTAATCATAGG - Intronic
1170095193 20:12638350-12638372 TTTAACTAGAGCTCAAACAAAGG - Intergenic
1173961105 20:47073291-47073313 CTTAAACAAAGCTTGATCAAAGG + Intronic
1178083319 21:29088463-29088485 CTTAAGGAGAGCTTATGAAAGGG - Intronic
1182910916 22:33983572-33983594 CTTTATGATTGCTTAATCAATGG - Intergenic
949261491 3:2106960-2106982 CTTATCGAGAACTGAAGCAAAGG - Intronic
949322160 3:2823680-2823702 TTTAACGAGAGCTTGGTTAAAGG - Intronic
950187957 3:10957017-10957039 CATAGTGAGTGCTTAATCAATGG + Intergenic
950976465 3:17251236-17251258 CTTAACAGGAACTTTATCAAAGG - Intronic
955594857 3:60577505-60577527 CTTAACGAAAACGTAGTCAATGG + Intronic
958442105 3:94168050-94168072 ATCAACGAGAGATTAATGAAAGG - Intergenic
962161907 3:133009823-133009845 CTTATCGGGAGCTGAAGCAAAGG + Intergenic
969271017 4:6102028-6102050 CTTAAGGAGATCTAAATCAATGG - Intronic
971168336 4:24207190-24207212 CCTAAAGAGAGGTTACTCAATGG + Intergenic
975256447 4:72241638-72241660 CTGAAGGAGAGTTTAAACAAGGG - Intergenic
976258487 4:83123599-83123621 ATGAATGAGAGCTTAATCAATGG - Intronic
977147635 4:93464909-93464931 CTAAAGTAGAGCTTAAACAACGG - Intronic
978870072 4:113565274-113565296 ATTAAAGAGGGCTTATTCAAAGG + Intronic
979429260 4:120608070-120608092 CTTAAAGATAGCTTAAAGAATGG - Intergenic
980348211 4:131652281-131652303 TTTAAAGACAGTTTAATCAATGG - Intergenic
985981063 5:3464041-3464063 CTTAGCCAGAGATTAATAAATGG - Intergenic
985990747 5:3558737-3558759 CTTAACGTGTTCTTTATCAATGG + Intergenic
987419153 5:17698016-17698038 TTTAACGAGAGCTGGATCATGGG - Intergenic
994992959 5:107020792-107020814 CTGAATGAGAGGTTAAGCAAAGG - Intergenic
995238027 5:109852486-109852508 CTCAAAGTGAGCTTAATAAAGGG + Intronic
997846053 5:137286945-137286967 CTTTACAAGAGCTTATTAAAAGG + Intronic
1002086774 5:176780806-176780828 TTTGAGGAGAGCTTAATGAAGGG - Intergenic
1004373279 6:15071127-15071149 CTTAATCAATGCTTAATCAATGG + Intergenic
1006507007 6:34495849-34495871 CTAAAGGAGAGATTACTCAAAGG + Intronic
1007950801 6:45870549-45870571 CTTAAGGACAGTTTAATGAAAGG - Intergenic
1011842913 6:91524564-91524586 TTTGAAGAGAGCTTAATCTAGGG + Intergenic
1012524477 6:100160840-100160862 CTGAAAGAGAAATTAATCAAAGG + Intergenic
1014466110 6:121759034-121759056 CTTAACCAGCACTTACTCAAAGG + Intergenic
1014741428 6:125151977-125151999 CTTAACCACAGCCTAATCCAGGG + Intronic
1014745430 6:125194884-125194906 CTTAGAGAGAGTTTATTCAAGGG + Intronic
1017068112 6:150548844-150548866 TTTAAAGAGAGTTTATTCAAGGG - Intergenic
1024679179 7:51665955-51665977 CTTATCGAGAACTCAATTAATGG + Intergenic
1025841542 7:65154175-65154197 CATAACAAGTGCTTAATAAATGG - Intergenic
1025881507 7:65541791-65541813 CATAACAAGTGCTTAATAAATGG + Intergenic
1025891932 7:65660824-65660846 CATAACAAGTGCTTAATAAATGG - Intergenic
1027218010 7:76196630-76196652 ATTGACGAGAGCTTGATGAAGGG + Intergenic
1042934520 8:74045580-74045602 CTTAAGGAGAGTTTAATAAAGGG + Intergenic
1055228816 9:74035132-74035154 CTTAACGAGAGATCATGCAAAGG + Intergenic
1187758414 X:22551351-22551373 CTTAATGAAAGTTTAATTAAGGG + Intergenic