ID: 1139397303

View in Genome Browser
Species Human (GRCh38)
Location 16:66650441-66650463
Sequence CTGAGACTACAGATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139397303 Original CRISPR CTGAGACTACAGATGCAGCC TGG Intronic
900426184 1:2580396-2580418 CTGGGACTACAGGTTCCGCCTGG - Intergenic
901041079 1:6363937-6363959 CTGGGACCACAGGTGCAGCTGGG - Intronic
901490615 1:9594626-9594648 CTGACACTACTGCTGCTGCCCGG - Intronic
904029665 1:27526241-27526263 CTGACACCACTGATGCAGGCAGG - Intergenic
904853333 1:33476033-33476055 ATGAGACTCCAGTTGCTGCCTGG + Intronic
905096975 1:35480953-35480975 CTGAGCCTAGAGATGGAGACAGG - Intronic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
907283497 1:53366025-53366047 CAGAGACTCCAGAGGCAGCACGG - Intergenic
907969139 1:59363722-59363744 GTGAGGCTAAAGAGGCAGCCAGG + Intronic
908432539 1:64073097-64073119 GTGAGACTGGAGATGAAGCCTGG - Intronic
910260358 1:85288258-85288280 CTAGGACTACAGGTGCAGACAGG - Intergenic
912693814 1:111824941-111824963 CTGAGACAACAAGTGCTGCCAGG - Intronic
913148511 1:116016519-116016541 ATGAAACTACAGATACAGGCTGG - Intronic
913397586 1:118389178-118389200 ATGAGACTGCAGATGTAGGCAGG + Intergenic
914290296 1:146266820-146266842 CTGAGATTAGAGATGCTGTCAGG + Intergenic
914551339 1:148717603-148717625 CTGAGATTAGAGATGCTGTCAGG + Intergenic
914710403 1:150208026-150208048 CTGGGACTACAGGTGCATGCAGG + Intergenic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
916020066 1:160783608-160783630 TGGAGCCTACAGATGCAGGCAGG - Intergenic
916069054 1:161159564-161159586 CTGCGGCTAAAGCTGCAGCCGGG + Exonic
917207886 1:172596887-172596909 CGGAGTCTACAGAGGCAGGCAGG + Intronic
917266657 1:173227978-173228000 TGGAGTCTACAGATGCAGGCAGG - Intergenic
918418298 1:184335660-184335682 CTGGGACTACAGGTGCATGCTGG - Intergenic
920407656 1:205730185-205730207 CTGGGACTACAGACGCATGCTGG + Intronic
920846142 1:209594583-209594605 CTCAGACTACAGAGTCAGCCAGG - Intronic
922749204 1:228062843-228062865 CTAAGGCTACAGATCCAGCCCGG + Intergenic
924053946 1:240106270-240106292 CACAGACTACATATGAAGCCTGG - Intronic
1063476879 10:6336562-6336584 CTGAGACCACAGGTGCAGCCAGG + Intergenic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1069121663 10:64576371-64576393 CTAAGACGCCAGCTGCAGCCAGG + Intergenic
1069532510 10:69229660-69229682 CTGAACCTTCAGAAGCAGCCAGG - Intronic
1070270553 10:74950406-74950428 CTGTTACTGCAGATGCAGACGGG + Intronic
1071415245 10:85435354-85435376 CTTAGACTACATATGCATGCAGG - Intergenic
1072720710 10:97779343-97779365 CTGAGACTGCAGAGGGAGCAGGG - Intergenic
1073356695 10:102860693-102860715 CTGAGACTACAGAAGAAGTGGGG + Intronic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1073914844 10:108390234-108390256 CTGAGGCTCCAGATGCAAGCAGG - Intergenic
1073924984 10:108504928-108504950 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1073996718 10:109324187-109324209 CTTTTACTACAGATTCAGCCAGG + Intergenic
1075082812 10:119395319-119395341 CAGTGACCACAGAGGCAGCCAGG - Intronic
1075557937 10:123446927-123446949 CACAGAGTCCAGATGCAGCCTGG - Intergenic
1075582768 10:123634586-123634608 CTGAGCCCACACATGCACCCAGG - Intergenic
1076652513 10:131999506-131999528 CTGCCACTCCAGACGCAGCCTGG - Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1080267203 11:30413960-30413982 CTGAGATTCCAGAAGCTGCCAGG + Intronic
1080839243 11:35969124-35969146 CTAATATTCCAGATGCAGCCAGG + Intronic
1082276450 11:50227116-50227138 CTGAGACTAAAAAGGCAGTCAGG - Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1086452184 11:86927817-86927839 CTGGGACTACAGGTGCAGGCTGG - Intronic
1087451565 11:98330378-98330400 TGGAGCCTACAGATGCAGGCAGG + Intergenic
1088302507 11:108374062-108374084 CTGAGCCTACAGAGGCAGGCAGG - Intronic
1088317950 11:108526535-108526557 CCGAGAGTACAGAAGCATCCTGG + Intronic
1090190720 11:124765228-124765250 CTCTGACTATAGATGCTGCCTGG + Intergenic
1091197245 11:133742190-133742212 CTGGGACTACAGGTGCATGCCGG - Intergenic
1091966498 12:4746652-4746674 CTGTGAGTACAGAAGCAGGCTGG - Intronic
1092254239 12:6917503-6917525 TGGAGACTACAGATGGAGGCAGG + Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1092670228 12:10853841-10853863 CTGAGTCTGCTGATGCAGCTGGG + Intronic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1094710451 12:32956711-32956733 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1095213383 12:39520645-39520667 CTGGGACTACAGGTGCATGCCGG - Intergenic
1095558025 12:43531621-43531643 CAGAGGCTACAGTTGCAGGCGGG + Intronic
1098138423 12:67427481-67427503 ATCAGACTACAGACGCAGACAGG - Intergenic
1099459419 12:82904224-82904246 CTGAGATTACAGATGGAGTTAGG + Intronic
1099658637 12:85527452-85527474 CTGTGACGAGAGAGGCAGCCTGG - Intergenic
1101345144 12:103879534-103879556 CTGAGGCTGCAGAGGCAGGCAGG - Intergenic
1103498382 12:121380896-121380918 CTGAAAATACAAATTCAGCCAGG - Intronic
1104403501 12:128497430-128497452 TGGAGTCTACAGATGCAGGCAGG + Intronic
1105992630 13:25637649-25637671 TGGAGTCTACAGAGGCAGCCAGG - Intronic
1106125791 13:26899042-26899064 CTGAGACTAAGGATGGAGCATGG + Intergenic
1106469018 13:30038438-30038460 CTGACTCTACTGATGCTGCCAGG + Intergenic
1106671626 13:31912229-31912251 CTGAATCTGCAGATCCAGCCTGG - Intergenic
1107922435 13:45223103-45223125 CTGAGACTACAGGCGTAGCTGGG - Intronic
1107991248 13:45820706-45820728 CAGAAACTGCAGAAGCAGCCAGG - Intronic
1108002275 13:45915260-45915282 CTGAGCCTACAGCTGTACCCGGG - Intergenic
1108043772 13:46363725-46363747 CTGGGACTACAGGTGCTGGCCGG - Intronic
1108600607 13:51991343-51991365 CTGGGACTACAGGTGCACACTGG - Intronic
1108691137 13:52860318-52860340 CTGATGCTACAGATGCAGACGGG + Intergenic
1110275870 13:73641047-73641069 TGGAGCCTACAGAGGCAGCCAGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112765073 13:102733043-102733065 CTCAGCCTACAGATGCTACCAGG - Exonic
1112842890 13:103601389-103601411 CTGAGTCCACAGTGGCAGCCCGG + Intergenic
1115335372 14:32240200-32240222 TGGAGCCTACAGATGCAGGCAGG + Intergenic
1116727214 14:48575858-48575880 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1119285911 14:73454169-73454191 CTGAGAGTACATATGCAGGTTGG - Intronic
1119968171 14:78940092-78940114 ATGAGTCTAAAGATGTAGCCAGG - Intronic
1121078633 14:91089927-91089949 CTGGGACAACAGATGTAACCCGG + Intronic
1121535817 14:94690071-94690093 CTGAGACCACAGAGCCACCCTGG + Intergenic
1122626637 14:103088393-103088415 CTGAGACTCTAGGTGCTGCCTGG + Intergenic
1125256224 15:37766566-37766588 CTGAGACTACAGATAGACCAAGG + Intergenic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1126771888 15:52065783-52065805 CTGACATTATAGATGCAGCTAGG - Exonic
1127121431 15:55775440-55775462 AAGAGACTACAGAGGGAGCCTGG - Intergenic
1128333017 15:66768617-66768639 CTGATCCTCCTGATGCAGCCTGG - Intronic
1129146916 15:73656598-73656620 CTGAGACTACAGGCGCACACTGG + Intergenic
1129331766 15:74831500-74831522 CTGAGACCACAGGTGGGGCCGGG + Exonic
1129542835 15:76364870-76364892 CTAAGACTAAAGAGGCAGGCAGG - Intronic
1131170091 15:90171901-90171923 CTGGGACTACAGGTGGTGCCTGG - Intronic
1131915862 15:97265499-97265521 CTGGGACTAAAGAAGGAGCCAGG - Intergenic
1132114587 15:99126196-99126218 TTGAAACCACAGATGCAGTCTGG + Intronic
1133134330 16:3699176-3699198 CTGAGACTGCAGCTGCAGAGTGG - Intronic
1133161728 16:3916287-3916309 CAGAGAGAGCAGATGCAGCCTGG + Intergenic
1134067861 16:11240823-11240845 CTGGGCTTCCAGATGCAGCCTGG - Intergenic
1138594561 16:58022904-58022926 CTGACAGTGCAGAAGCAGCCGGG + Intergenic
1138596779 16:58033288-58033310 GTGATACTTCAGAAGCAGCCTGG + Intronic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1140262701 16:73394504-73394526 CTAAGAGTTCAAATGCAGCCTGG - Intergenic
1140923389 16:79560177-79560199 CTGGGACTACAGGTGCACCTGGG + Intergenic
1141568263 16:84918068-84918090 CTGAGGCCACAGAGCCAGCCCGG - Intronic
1142004944 16:87685250-87685272 CAGAGCCTGCAGCTGCAGCCTGG + Intronic
1142284277 16:89165408-89165430 CCTGGACTATAGATGCAGCCGGG + Intergenic
1142558553 17:796075-796097 CTGAGACAGCAGCTGAAGCCAGG + Intergenic
1142697660 17:1642842-1642864 CTGGGACTACAGGCGCAGCCCGG + Intronic
1143085699 17:4414318-4414340 CTGAGATTACAGGTGTAGCTGGG - Intergenic
1146114548 17:30123231-30123253 CTAGGACTACAGGTGCAGCTGGG + Intronic
1146626464 17:34438983-34439005 TTGAAACTTCAGATGCAGCAAGG - Intergenic
1146767166 17:35533936-35533958 CTGGGACTACAGGTGCAGCCTGG - Intronic
1147945117 17:44076412-44076434 CAGAGACTACTGGAGCAGCCTGG - Intergenic
1150284330 17:63946760-63946782 CAGAGACTGCAGAAGCACCCAGG - Intronic
1151554745 17:74841027-74841049 CAGAGACTAAAGAGGCAGCCTGG + Intergenic
1152029299 17:77831698-77831720 CTGAGACTACATCAGCAGCCCGG - Intergenic
1157219313 18:45814738-45814760 CTAAGACCACACATCCAGCCAGG + Intergenic
1161711608 19:5851644-5851666 TTCAGGCTACAGATGGAGCCCGG - Intergenic
1161927992 19:7315669-7315691 CTGAGTTTACAGCTGCTGCCTGG - Intergenic
1162110959 19:8399524-8399546 CTGAGCCTCCACCTGCAGCCTGG - Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163284035 19:16335241-16335263 CTGAGGCGACAGATGCCGGCTGG - Intergenic
1165878871 19:39028906-39028928 CTGGGACTACAGGTGCATACTGG - Intronic
1166578342 19:43866764-43866786 TGGAGCCTACAGATGCAGGCAGG + Intergenic
1166740178 19:45109850-45109872 CTGAGGCTGCAGATGCAGGTGGG - Intronic
1168382200 19:55933381-55933403 CTGGGACTACAGGTGCATACTGG + Intergenic
1168594927 19:57667783-57667805 TTGAGACTGCAGAAGCAGACAGG + Intergenic
926489771 2:13510788-13510810 CTGAGAGTACAGTTGAAGCAAGG + Intergenic
927692949 2:25221272-25221294 CTTGGACTACAGCTGCAGCAGGG + Intergenic
927866067 2:26588405-26588427 CTGAGGCTGCAGAGGCCGCCTGG - Intronic
928148723 2:28807025-28807047 CTGAGACCACGTATTCAGCCTGG - Intronic
928353101 2:30581156-30581178 CTCAGACTACAGAGCCAGTCTGG + Intronic
929398059 2:41546295-41546317 TTCAGACTACAGATTCAGCTGGG + Intergenic
930129408 2:47833961-47833983 TTGAAAATAAAGATGCAGCCAGG - Intronic
930163773 2:48183727-48183749 TTGAAACTGAAGATGCAGCCAGG + Intergenic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
931941376 2:67255250-67255272 CTTAGACGTCAGCTGCAGCCTGG + Intergenic
932293895 2:70608552-70608574 CTGTTACTGCAGATTCAGCCAGG - Intronic
932423428 2:71614357-71614379 GTGAAACTACAGATGCAGCAAGG - Intronic
932808491 2:74804235-74804257 TTAAGACAACATATGCAGCCGGG + Intergenic
936012559 2:108934287-108934309 CTCAGACTGCAGATACAGGCAGG + Intronic
936391361 2:112077250-112077272 CGGAGAATACAGATGCAAGCTGG + Exonic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
937581717 2:123496163-123496185 ATGAGGCTACAGGTGCAGGCTGG - Intergenic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938089317 2:128420905-128420927 CCAGGACAACAGATGCAGCCTGG - Intergenic
940814064 2:158278663-158278685 CGGAGCCTACAGAGGCAGGCAGG - Intronic
944538736 2:200736940-200736962 CTGAGATTACTGAGGCAGCGGGG + Intergenic
944891414 2:204120904-204120926 CAGTGGCTACAGAGGCAGCCAGG - Intergenic
945235855 2:207630692-207630714 CTGAGAACCCAGGTGCAGCCAGG - Intergenic
945652792 2:212585538-212585560 CTGGGATTATAGGTGCAGCCAGG - Intergenic
946958045 2:224953390-224953412 CTGAGCCTGCAGATGCACCATGG - Intronic
947680151 2:232023521-232023543 CTGAGACTACAGCTGGAACCTGG + Intronic
947868052 2:233415057-233415079 CTGAGACTACAGGTACATGCTGG + Intronic
1168997882 20:2146254-2146276 CTGAAACTACAGGTGCTACCCGG - Exonic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1171140314 20:22735187-22735209 GTGAGTCTACAGAGGCAGGCAGG - Intergenic
1171979671 20:31618725-31618747 CTGGGACTACAGATGCACCCTGG - Intergenic
1173074358 20:39802591-39802613 CGGAGCCTACAGAGGCAGGCAGG + Intergenic
1174966869 20:55225928-55225950 TGGAGCCTACAGATGCAGGCAGG + Intergenic
1175512161 20:59537256-59537278 TGGAGCCTACAGATGCAGGCAGG + Intergenic
1176094219 20:63332590-63332612 CTGAGACCACATTGGCAGCCAGG + Intronic
1177780983 21:25622143-25622165 ATGAGACCACAGGTGCAGGCTGG + Intergenic
1177958462 21:27630522-27630544 CTGAGAATACAACTGCACCCAGG + Intergenic
1178044268 21:28676528-28676550 CTGAAAATACAGAGACAGCCAGG + Intergenic
1179022934 21:37656407-37656429 CTGGGTCTGCAGCTGCAGCCCGG - Intronic
1180036858 21:45254496-45254518 CTGAGAAAGCAGACGCAGCCGGG + Intergenic
1181110351 22:20599091-20599113 CCGAGACAGCACATGCAGCCAGG + Intergenic
1183130886 22:35834779-35834801 ATGAGACTAGAGAGACAGCCAGG + Intronic
1184105557 22:42365684-42365706 CTGAGACTTCACAGGGAGCCGGG + Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
949468364 3:4367325-4367347 TGGAGCCTACAGAGGCAGCCAGG + Intronic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
951934951 3:28012294-28012316 ATGAAATTACAGATGGAGCCAGG + Intergenic
952693111 3:36233442-36233464 CTGAAACTACTGATGCCACCTGG + Intergenic
954160779 3:48720235-48720257 CTGGGACTACAGGTGTAGCTGGG - Intronic
954226691 3:49186265-49186287 CTGGGATTACAGGTGTAGCCTGG + Intronic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
955637273 3:61043519-61043541 TGGAGACTACAGAGGCAGGCAGG - Intronic
955669786 3:61391630-61391652 TGGAGACTACAGAGGCAGGCAGG - Intergenic
957181577 3:76885864-76885886 CTGAGACAAGAGATGCAACTGGG + Intronic
958829891 3:99074121-99074143 TGGAGTCTACAGAGGCAGCCAGG + Intergenic
960832342 3:121863294-121863316 TGGAGTCTACAGATGCAGGCAGG + Intronic
963825174 3:149945459-149945481 TGGAGACTACAGAGGCAGGCAGG - Intronic
963906665 3:150778965-150778987 CTTGGAGGACAGATGCAGCCTGG - Intergenic
964318557 3:155469588-155469610 TGGAGCCTACAGATGCAGGCAGG - Intronic
964536253 3:157725220-157725242 TGGAGCCTACAGATGCAGGCAGG - Intergenic
966248456 3:177835010-177835032 GTGTGACTACACATGCACCCAGG + Intergenic
966361277 3:179132317-179132339 CGGAGCCTACAGAGGCAGGCAGG + Intergenic
967149380 3:186634582-186634604 CTAAGACCACACATCCAGCCAGG - Intergenic
967490076 3:190080267-190080289 CTGAGGCTACAGAGTAAGCCAGG + Intronic
968442495 4:631000-631022 CTGAGACCAGTGACGCAGCCAGG + Intronic
969083146 4:4635747-4635769 GTGAGACATCAGATGTAGCCAGG + Intergenic
971539935 4:27803369-27803391 CTGAGAAGCTAGATGCAGCCAGG - Intergenic
973055378 4:45651712-45651734 TGGAGCCTACAGATGCAGGCAGG - Intergenic
974254252 4:59429027-59429049 TGGAGTCTACAGATGCAGGCAGG - Intergenic
975062402 4:70019128-70019150 TGGAGCCTACAGATGCAGGCAGG + Intergenic
978176232 4:105735274-105735296 TGGAGACTACAGAGGCAGGCAGG + Intronic
978954087 4:114594534-114594556 CTGAGCCTCCAGAGGCAGCCAGG + Intergenic
979078884 4:116309743-116309765 CTGAGACAACAAATGTTGCCAGG + Intergenic
979112795 4:116780512-116780534 TGGAGCCTACAGATGCAGGCAGG + Intergenic
981441826 4:144792122-144792144 TGGAGACTACAGAGGCAGGCAGG - Intergenic
982052091 4:151511822-151511844 CGGAGCCTACAGAGGCAGGCAGG - Intronic
982637058 4:157910059-157910081 GTGAGACCTCAGCTGCAGCCTGG + Intergenic
983101624 4:163632759-163632781 TTGAGCCTACAGAGGCAGGCAGG - Intronic
983704362 4:170639753-170639775 TTGAGCCTACAGAGGCAGGCAGG - Intergenic
984029706 4:174587444-174587466 CTGAAACTACACATTCAGCCTGG - Intergenic
984647726 4:182237521-182237543 CTGGGATTACAGACGTAGCCAGG - Intronic
985318443 4:188682584-188682606 CTGAGAATAAAGGTGCAGCTTGG - Intergenic
985420120 4:189776888-189776910 CTGTGACTGCAGGTGCAGCAGGG - Intergenic
985870791 5:2554801-2554823 CTGGAACTCCAAATGCAGCCTGG + Intergenic
986176596 5:5357751-5357773 CTGAAACTACAGATGCTGTTTGG + Intergenic
989942848 5:50174420-50174442 TTGAGCCTACAGAGGCAGGCAGG + Intergenic
989956543 5:50367295-50367317 TTGAGTCTACAGAGGCAGGCAGG - Intergenic
991282594 5:64933154-64933176 CTGATACTGCAGATCCAGTCTGG + Intronic
992525821 5:77609191-77609213 TGGAGCCTACAGATGCAGGCAGG - Intronic
992820544 5:80491633-80491655 CAGAGGCTAGGGATGCAGCCAGG - Intronic
994539550 5:101077203-101077225 ATGAGGCCACAGATGCAGGCTGG - Intergenic
995205326 5:109473274-109473296 CTGGGACTACAGGTGCACACTGG + Intergenic
995805822 5:116051327-116051349 CTGGGAGTACAGATACAGTCTGG + Intronic
996827563 5:127702772-127702794 CTGGGTCTACAAATGCATCCAGG + Intergenic
997907661 5:137835527-137835549 CTGAGATTACAGGTGCACGCCGG - Intergenic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
998689775 5:144574697-144574719 CTGAGACTCCAGAGACTGCCTGG + Intergenic
998945915 5:147339174-147339196 CTGAGACTACGAAAGCAGCAAGG - Intronic
1000158638 5:158577471-158577493 GTGAGTCTACAGAGGCAGGCAGG + Intergenic
1001647409 5:173292418-173292440 CTGAGATGTCAGCTGCAGCCTGG + Intergenic
1001652225 5:173324095-173324117 TTCAGACTCCAGATGCTGCCAGG - Intronic
1003553102 6:7116207-7116229 CTGAGACTAGAAATTCAGCTTGG - Intronic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1006828731 6:36955983-36956005 CTGAGAGAACAGATGCACCTTGG + Intronic
1007128366 6:39446625-39446647 CTGGGACTACAGGTGCCACCAGG + Intronic
1009239155 6:61163206-61163228 TGGAGACTACAGAGGCAGACAGG + Intergenic
1009428365 6:63539633-63539655 CTGGGACTACAGGCACAGCCTGG - Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1010009393 6:71032694-71032716 CTGAGCCTTCAGAGGCAGGCTGG - Intergenic
1010102462 6:72125593-72125615 TGGAGTCTACAGATGCAGGCAGG + Intronic
1011458650 6:87579858-87579880 CTGGGACTACAGCCTCAGCCTGG + Intronic
1012203909 6:96437506-96437528 TGGAGACTACAGAGGCAGGCAGG - Intergenic
1012537228 6:100313512-100313534 CTGAAATTACAGGTGCAGCCTGG + Intergenic
1013378237 6:109540202-109540224 TGGAGTCTACAGATGCAGTCAGG + Intronic
1013640552 6:112073907-112073929 CTGGGACTACAAGTGCAGACAGG + Intronic
1014842877 6:126240808-126240830 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1015120586 6:129697123-129697145 CTGAGAGTACAGCAGTAGCCAGG - Intronic
1015549569 6:134398029-134398051 CTGATATTACAGATGGATCCAGG + Intergenic
1015811331 6:137164597-137164619 CTGAGTCTCCGGAGGCAGCCGGG - Intronic
1016522004 6:144956044-144956066 CTGAGACTGCAAATACAGCTTGG + Intergenic
1018532979 6:164787437-164787459 CGGAGCCTACAGAGGCAGGCAGG + Intergenic
1018566654 6:165161885-165161907 CTGAGTCTAAAATTGCAGCCTGG - Intergenic
1018749341 6:166789404-166789426 CGGAGCCTACAGAGGCAGGCAGG - Intronic
1018756049 6:166850716-166850738 GTGAGACCTCAGAAGCAGCCTGG - Intronic
1023899299 7:44463089-44463111 CGAAGGCTACACATGCAGCCTGG + Intronic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1023935864 7:44739305-44739327 CTCAGAGTACAGCAGCAGCCAGG - Intergenic
1024074654 7:45812321-45812343 CTGGGCCGAGAGATGCAGCCAGG + Intergenic
1025052313 7:55741560-55741582 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025052707 7:55743108-55743130 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130291 7:56371344-56371366 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130611 7:56372642-56372664 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130929 7:56373936-56373958 CTGAGCCGAGAGATGCAGCCAGG - Intergenic
1025177815 7:56810829-56810851 CTGGGCCTACAGAGGCCGCCGGG + Intergenic
1025177972 7:56811475-56811497 CTGGGCCTACAGAGGCCGCCGGG + Intergenic
1025690995 7:63753365-63753387 CCGGGCCTGCAGATGCAGCCGGG - Intergenic
1025693934 7:63765396-63765418 CTGGGCCTACAGAGGCCGCCGGG - Intergenic
1025887142 7:65606933-65606955 CTGAGAGTACATCTGCAGACAGG + Intergenic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1028458239 7:91061999-91062021 TGGAGACTACAGAGGCAGGCAGG + Intronic
1029115763 7:98236326-98236348 CTGAGACCACTGCTGCAGGCTGG + Intronic
1030608826 7:111667148-111667170 CTAAGACTACAGCTTCTGCCAGG - Intergenic
1030833508 7:114255390-114255412 TGGAGTCTACAGATGCAGGCAGG + Intronic
1031855273 7:126914995-126915017 CTGAGAGTACATCTGCAGACAGG - Intronic
1033960394 7:146906314-146906336 TGGAGCCTACAGAGGCAGCCAGG - Intronic
1034860884 7:154593691-154593713 CTGACACCTCAGGTGCAGCCAGG - Intronic
1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG + Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1039746390 8:40431722-40431744 CTGGGACTACAGAGGCACGCCGG - Intergenic
1040427419 8:47303044-47303066 GTGAGTCTACAGAGGCAGGCAGG + Intronic
1040566964 8:48576175-48576197 CTGAGACCTAAGATGCAGGCTGG - Intergenic
1040749903 8:50692850-50692872 CGGAGCCTACAGAGGCAGGCAGG + Intronic
1040909875 8:52507001-52507023 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1041040297 8:53839928-53839950 CTGAGGCTAGAGAGGCAGCCAGG - Intronic
1041217606 8:55616247-55616269 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1041387494 8:57319644-57319666 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1041629381 8:60068371-60068393 CTAAGACAACAGATGAAACCAGG - Intergenic
1042332519 8:67595487-67595509 TGGAGACTACAGAGGCAGGCAGG + Intronic
1045077774 8:98589577-98589599 TGGAGCCTACAGATGCAGGCAGG + Intronic
1045408527 8:101892025-101892047 TGGAGCCTACAGAGGCAGCCAGG - Intronic
1045788726 8:105956197-105956219 TGGAGACTACAGAGGCAGGCAGG - Intergenic
1047905090 8:129464459-129464481 CTGAGGGAACAGAAGCAGCCTGG - Intergenic
1048991495 8:139762966-139762988 ATGAGGCTGCAGCTGCAGCCGGG + Intronic
1049278540 8:141732178-141732200 CTGAGACAGCAGAGTCAGCCGGG - Intergenic
1050034837 9:1424344-1424366 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1050064250 9:1742198-1742220 CTGAAGCTAAAGATGCAGCTGGG - Intergenic
1052577272 9:30306266-30306288 ATGAGACCACAGGTGCAGGCTGG - Intergenic
1052696803 9:31888749-31888771 CGGAGTCTACAGAGGCAGGCAGG + Intergenic
1053472837 9:38359143-38359165 CTCAGTCTACAGAGCCAGCCGGG + Intergenic
1056653394 9:88488555-88488577 CTGAGGCTATAAATCCAGCCTGG - Intergenic
1057772562 9:97982021-97982043 CTGAGACTACAAACGGAGTCAGG + Intergenic
1058241572 9:102568918-102568940 CTGACACCACAGATGCTGCAGGG + Intergenic
1058290801 9:103238011-103238033 TGGAGCCTACAGAGGCAGCCAGG - Intergenic
1058444960 9:105046699-105046721 ATGAGACTAGAGAGGTAGCCAGG + Intergenic
1059713532 9:116891590-116891612 GTCAGAATACAGATGCAGGCAGG + Intronic
1060306150 9:122414244-122414266 TTGAGTCTACAGAGGCAGGCAGG + Intergenic
1061397662 9:130352346-130352368 CAGAGAGTGCAGATGCAGGCTGG - Intronic
1061527437 9:131178440-131178462 CCGCTACTACAGAAGCAGCCAGG - Intronic
1188043967 X:25404199-25404221 CTGAGTCTACAGAGGCAGGCAGG + Intergenic
1188276478 X:28207292-28207314 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1190800503 X:53783879-53783901 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1191020212 X:55851369-55851391 TGGAGACTACAGAGGCAGGCAGG + Intergenic
1191635150 X:63367960-63367982 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1191750388 X:64535969-64535991 CTGAGACAAGACATGCAGTCAGG + Intergenic
1191782029 X:64879218-64879240 TTGAGTCTACAGAGGCAGGCAGG - Intergenic
1192007673 X:67234623-67234645 TGGAGTCTACAGATGCAGGCAGG - Intergenic
1192492155 X:71585397-71585419 CTGAGACTAACGATCCACCCTGG - Intronic
1192595777 X:72406932-72406954 CTGAAACTACATATGCCCCCAGG + Intronic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1193025440 X:76841165-76841187 CGGAGCCTACAGAGGCAGGCAGG - Intergenic
1194441571 X:93940268-93940290 TGGAGCCTACAGATGCAGGCAGG - Intergenic
1195211680 X:102656297-102656319 CTGAGACTAGAGAAGAAGACAGG + Exonic
1195395756 X:104408833-104408855 TGGAGTCTACAGATGCAGGCAGG + Intergenic
1195406295 X:104517585-104517607 ATAAGACTACAGATTCAGCCGGG - Intergenic
1195417525 X:104636442-104636464 TGGAGTCTACAGATGCAGGCAGG + Intronic
1195510348 X:105709171-105709193 CAGAGCCAACAGAAGCAGCCAGG + Intronic
1196621829 X:117833044-117833066 TAGAGACTACAGAGGCAGGCAGG + Intergenic
1197915014 X:131525008-131525030 TTGAGTCTACAGAGGCAGGCAGG - Intergenic
1198166426 X:134062252-134062274 TTGAGTCTACAGAGGCAGGCCGG + Intergenic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1199290401 X:146099009-146099031 CTGAGATTACAGGCGCAGCTGGG + Intergenic
1199943677 X:152648905-152648927 CTGAGACTCCAGATGCAATGTGG - Intronic
1200874579 Y:8139800-8139822 TGGAGCCTACAGATGCAGGCAGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201626811 Y:16024032-16024054 TGGAGTCTACAGATGCAGGCAGG + Intergenic
1201909495 Y:19119898-19119920 TGGAGTCTACAGATGCAGCCAGG + Intergenic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic