ID: 1139402059

View in Genome Browser
Species Human (GRCh38)
Location 16:66690517-66690539
Sequence TGTTCTCTGGAGGATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139402059_1139402068 30 Left 1139402059 16:66690517-66690539 CCCTGCACATCCTCCAGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1139402068 16:66690570-66690592 TGAGATTTAAAAAACTAACAAGG 0: 1
1: 0
2: 4
3: 44
4: 568
1139402059_1139402063 -10 Left 1139402059 16:66690517-66690539 CCCTGCACATCCTCCAGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1139402063 16:66690530-66690552 CCAGAGAACAGTAACCAGCCAGG 0: 1
1: 0
2: 3
3: 24
4: 183
1139402059_1139402066 5 Left 1139402059 16:66690517-66690539 CCCTGCACATCCTCCAGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1139402066 16:66690545-66690567 CAGCCAGGGATTGTGCTGACTGG 0: 1
1: 0
2: 1
3: 14
4: 174
1139402059_1139402064 -9 Left 1139402059 16:66690517-66690539 CCCTGCACATCCTCCAGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 232
Right 1139402064 16:66690531-66690553 CAGAGAACAGTAACCAGCCAGGG 0: 1
1: 0
2: 2
3: 26
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139402059 Original CRISPR TGTTCTCTGGAGGATGTGCA GGG (reversed) Intronic
900134534 1:1109855-1109877 TGGTCTATGGAGGATGTGACTGG - Intronic
901261696 1:7876082-7876104 TGACCTCTGGACAATGTGCATGG - Intergenic
901876669 1:12170565-12170587 TGTTTTCTGGAGGAGTAGCAGGG + Intronic
903173979 1:21569876-21569898 TGTTTTCTGGAGGCCGTGGAGGG - Intronic
906426542 1:45718617-45718639 TATACTCTGGAGGCTGGGCAAGG - Intronic
906694098 1:47812435-47812457 TGTTCACCGCAGGCTGTGCATGG + Intronic
907109156 1:51910660-51910682 TGTTTTCTGTAAGATCTGCAAGG - Exonic
907432018 1:54418018-54418040 TCTTCTCTGGGGGCTGGGCATGG + Intergenic
908367809 1:63444342-63444364 TGTTCTCTGTTGGATTTTCATGG + Intronic
912426642 1:109598882-109598904 TGTGCTCTGGGGGCTGTGCCGGG + Exonic
913199338 1:116483533-116483555 TTTGATCTGGAGGATGTGAAGGG - Intergenic
915035681 1:152922091-152922113 TATTCACTGAAGGATCTGCAGGG - Intergenic
921955833 1:220982478-220982500 AGTCATCTGGAGGATGTGCAAGG - Intergenic
923354284 1:233138507-233138529 TGTTCTCAGGGGGAGTTGCAGGG + Intronic
923532612 1:234823387-234823409 AGTGCTCAGGAGGATGAGCATGG - Intergenic
1063256950 10:4339130-4339152 TGTTCTGTGGAGCATGTGGTGGG - Intergenic
1065807475 10:29408300-29408322 TATTTTCAGTAGGATGTGCAGGG + Intergenic
1067084127 10:43229296-43229318 TGCTCTGAGGAGGATGTGCCGGG - Intronic
1067528388 10:47052082-47052104 TGTCCTCTGCAGGCTGTGCTGGG + Intergenic
1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG + Intergenic
1069303526 10:66938928-66938950 CTTTCTCAGGAGGATGTGGACGG - Intronic
1071491233 10:86137992-86138014 GGTTGTCTGGAGAATCTGCAGGG + Intronic
1071684683 10:87742687-87742709 TGTTTTCTGGGGCCTGTGCAAGG - Intronic
1071815240 10:89225582-89225604 TGTTCTTTGGGGGAGGGGCATGG - Intronic
1071987417 10:91066190-91066212 TGTTGTCTGGAGCATCTGGAGGG - Intergenic
1077231404 11:1459584-1459606 TGTCCACTGGAGGCTGTGCCTGG + Intronic
1077465991 11:2733987-2734009 TGCTCTGAGGAGGATGTTCAGGG - Intronic
1078826194 11:14932758-14932780 TATTTTCAGGAGGATGTGCATGG - Intronic
1080740825 11:35063011-35063033 TGTTGTATGGAGGATGGTCAGGG + Intergenic
1080853412 11:36090997-36091019 TGTTGTCGGGATGATTTGCAGGG + Intronic
1083214778 11:61211561-61211583 TTTTCTCTGGAGGCTGTCTAGGG - Intronic
1083217662 11:61230390-61230412 TTTTCTCTGGAGGCTGTCTAGGG - Intronic
1083220658 11:61250140-61250162 TTTTCTCTGGAGGCTGTCTAGGG - Intronic
1083573598 11:63773191-63773213 TGCTCTCTGGAGAATGTTGAAGG - Intergenic
1083806808 11:65079299-65079321 TGTGCTCTGGGAGACGTGCAGGG - Intronic
1084235901 11:67787957-67787979 TGTGCTCTGGAGGCTGTGGCTGG + Intergenic
1084982623 11:72839132-72839154 TTTGCTTTGGAGGATGTGCTAGG - Intronic
1085595054 11:77801784-77801806 CGCTCTCTGGAGGAAGTGGATGG - Intronic
1086343746 11:85874337-85874359 TGATCACTGGAGGATGTGCATGG - Intronic
1086561345 11:88173276-88173298 TGTTCTCTAGGAGATCTGCAAGG - Intronic
1087905673 11:103694256-103694278 TGTGCTCTGCAGTATGGGCATGG - Intergenic
1090482098 11:127077933-127077955 GTTTCTCTGGAGGGTGTGGACGG + Intergenic
1090799847 11:130163578-130163600 TGTTCTCTAGAGCATGTGCTGGG + Intronic
1092034914 12:5324968-5324990 TTTATTCTGGTGGATGTGCACGG + Intergenic
1092090412 12:5799217-5799239 TGTTCTCTGGGAGGGGTGCATGG - Intronic
1092962059 12:13605866-13605888 TGTTAAGTGGAGGATCTGCATGG - Intronic
1094667679 12:32537538-32537560 TGTTCTTTCAATGATGTGCAAGG + Intronic
1095477468 12:42600495-42600517 TGTTCTCAGAAGGAAGAGCAAGG - Intergenic
1096319662 12:50600492-50600514 TGTTCACTGGAGGCTGGGTAGGG + Intronic
1096875964 12:54630761-54630783 TGGGCCCTGGAGGAAGTGCAGGG - Intergenic
1097373645 12:58815168-58815190 TGTTCTTTGGAGGATGGTCCAGG - Intergenic
1098078124 12:66755625-66755647 TGTTCTCTTGAGGCTGTGGCTGG + Intronic
1101236616 12:102796077-102796099 GGTGCTCTGGAGGATCTGGAAGG + Intergenic
1101999918 12:109550960-109550982 TCTTCTCTGGGGGAAGTGAAGGG - Intergenic
1103212076 12:119174608-119174630 TATTTTCTGGAGGATGTGCTGGG + Intergenic
1103458461 12:121085693-121085715 TGTTGCCTGGAGGAGGTGCTTGG + Intergenic
1103673247 12:122635569-122635591 TTTTCCCTGGAGGATGTGGTTGG + Intergenic
1104494026 12:129219802-129219824 TGATCTCTGGATGACCTGCAGGG - Intronic
1106642845 13:31603891-31603913 GGTTTACAGGAGGATGTGCATGG + Intergenic
1107382824 13:39875645-39875667 TGTTTTCTGGAGGACATGAAGGG + Intergenic
1108590936 13:51912404-51912426 AGCTCTGTGGAGGATGTGCCAGG - Intergenic
1112948628 13:104962031-104962053 TGTCATCTGGAGGGAGTGCAGGG + Intergenic
1113320672 13:109229159-109229181 CCTTTTCTGGAGGTTGTGCAGGG + Intergenic
1113694324 13:112333125-112333147 TGTTCTCTGGAGCCTGTGTCCGG - Intergenic
1117711744 14:58537503-58537525 TGTTCTCTGTAGAATTTGAAAGG + Intronic
1119227022 14:72952142-72952164 TGTTTTCTGAATGATGTGCACGG - Intronic
1120298625 14:82677543-82677565 TGTTCTCTTGAGGTTATGCTTGG - Intergenic
1120603176 14:86537870-86537892 TTTTCTCTCCAGGATTTGCATGG - Intergenic
1121486887 14:94323212-94323234 TTTGCTCTGGAGGCTGGGCAGGG + Intronic
1121867832 14:97379302-97379324 TGTTCTCTGGAAGAATGGCAGGG - Intergenic
1123145738 14:106128489-106128511 TGTTATCAGGAGTATGTGCATGG + Intergenic
1124165091 15:27319269-27319291 TGCTCTCTTGATGATGTGGATGG + Intronic
1125399586 15:39286632-39286654 AGTTCACTGGAGGAGATGCAGGG - Intergenic
1128565067 15:68695640-68695662 TGTTCTTTGCAGGCTGGGCAGGG + Intronic
1128694892 15:69754052-69754074 TGCCCTGTGGAGGGTGTGCAAGG - Intergenic
1129617255 15:77108469-77108491 TTTTCTGTTGAGGATATGCAGGG - Exonic
1130892812 15:88147929-88147951 TGTTCTCATTAGGATGTACAGGG + Intronic
1132114041 15:99122993-99123015 TTTTCTTTGGAGGATGTAGAAGG + Intronic
1133019952 16:2963021-2963043 TGTGCTCTGGAGGAGGGGCGTGG - Intergenic
1133381726 16:5336569-5336591 TATCCTCTGGAGTAGGTGCAGGG + Intergenic
1133612391 16:7445607-7445629 TGTTCTCTGGATTCTGTGCAGGG - Intronic
1133647862 16:7781196-7781218 CATTCTGTGGAGGATGTGCATGG + Intergenic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1136693367 16:32053310-32053332 TGTTATCAGGAGTATGTGCATGG - Intergenic
1136793858 16:32996533-32996555 TGTTATCAGGAGTATGTGCATGG - Intergenic
1136876053 16:33857846-33857868 TGTTATCAGGAGTATGTGCATGG + Intergenic
1137837592 16:51607910-51607932 TGTTTTCTGGAAGATGTGCTTGG + Intergenic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1139783414 16:69370429-69370451 TGTGCCCTTGAGGATGTGCGGGG - Intronic
1140095028 16:71867829-71867851 TGTGCTCTGGGGATTGTGCATGG - Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1142014877 16:87740105-87740127 TGTCCCCTGGAGAAGGTGCAGGG - Intronic
1142295866 16:89221833-89221855 TGTTTTCTTGAGGAAGTGTATGG + Intronic
1203096120 16_KI270728v1_random:1258226-1258248 TGTTATCAGGAGTATGTGCATGG - Intergenic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1144108543 17:12009036-12009058 TGTTCACTGGAGGAAATGAAGGG + Intergenic
1145791737 17:27631911-27631933 TGTGCTCTGAAGGTTGGGCATGG + Intronic
1147865661 17:43550398-43550420 TTTTTTGTGGAGGAGGTGCAGGG + Intronic
1151488905 17:74420384-74420406 TGTTATCAGGAGGCAGTGCAAGG + Intergenic
1151672496 17:75579137-75579159 TGTTCCCTGAAGGTTGTTCAAGG + Intergenic
1152716519 17:81903099-81903121 TGCTCCCTGGGGGAAGTGCAGGG + Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1156282360 18:35652377-35652399 TGTTTTCTGCAGTATGTGGAAGG + Intronic
1156871334 18:41948978-41949000 TGTTCTCTGAAGAATCTGCTTGG - Intergenic
1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG + Intronic
1159038470 18:63299764-63299786 TGCTCTCTGGAGAATGTGAAAGG - Intronic
1159188697 18:65013494-65013516 TGTTGTCTGGAGGTTGTCCTCGG - Intergenic
1160207775 18:76850292-76850314 TGTTCTCTAAAGGAGGTCCATGG - Intronic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1162260992 19:9534016-9534038 CGTTCGCTGGAGGATGAGGAAGG + Intronic
1162280576 19:9693870-9693892 TGTTCACTGGAGAATGAGGAAGG + Intronic
1163391339 19:17032397-17032419 TGTACTCTTGAGGTTATGCATGG + Intergenic
1164464609 19:28476703-28476725 TGCCCTCAGGAGGATGAGCAGGG - Intergenic
1164485893 19:28655306-28655328 TAGTTTCTGGGGGATGTGCATGG - Intergenic
1164958200 19:32405266-32405288 TGCTCTGTGGCGGATGCGCAGGG - Intergenic
1166118547 19:40670655-40670677 TGTTCACTGGAGCATCTACATGG - Intronic
1166866096 19:45838359-45838381 GGTACTCTGGAGGAGGTGGATGG + Intronic
1168190756 19:54737164-54737186 TGTATACAGGAGGATGTGCATGG + Intronic
1168200897 19:54815038-54815060 TGTACACAGGAGGATGTGCATGG + Intronic
1168203127 19:54831303-54831325 TGTATACAGGAGGATGTGCATGG + Intronic
1168205682 19:54849094-54849116 TGTATACAGGAGGATGTGCATGG + Intronic
1168208152 19:54867735-54867757 TGTATACAGGAGGATGTGCATGG + Intergenic
1168312439 19:55467705-55467727 GGGTCTCTGGAGGATGGGAAGGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926075312 2:9938102-9938124 TGCTATCAGGAGGATGTGGAAGG - Intergenic
928942689 2:36742538-36742560 TGTTCTATGTAGGATGTGGAAGG - Intronic
929810489 2:45185349-45185371 TCTTCTCTGGTGAATGTGCCAGG - Intergenic
930442352 2:51425002-51425024 TGGACCCTGGAGGATGAGCAAGG + Intergenic
931704097 2:64932602-64932624 TGTGGTCAGGAGGTTGTGCAGGG + Intergenic
931772163 2:65506867-65506889 TATTCTCTGGAGGAAGTTAATGG - Intergenic
932128512 2:69167011-69167033 TGTTCACTGGGGAATGTGCAGGG + Intronic
934578664 2:95420331-95420353 GCTTCTCTGTAGGATTTGCAAGG + Intergenic
934600778 2:95656378-95656400 GCTTCTCTGTAGGATTTGCAAGG - Intergenic
936534153 2:113298516-113298538 GCTTCTCTGTAGGATTTGCAGGG - Intergenic
937238598 2:120445906-120445928 TTTTCTCTGGTGGATGTCTATGG - Intergenic
938760236 2:134418673-134418695 TGCTGGGTGGAGGATGTGCAGGG + Intronic
941352536 2:164454455-164454477 TGCTCTCTGGGGGATGATCAGGG + Intergenic
942051152 2:172142236-172142258 CGCTCTCTGGAGGAAGAGCATGG - Intergenic
946956901 2:224940776-224940798 TGCTCTCTGTAGGAGGTGCCTGG + Intronic
948166364 2:235865653-235865675 GGTGCTCTGGAGGAGGGGCAGGG + Intronic
948783231 2:240337525-240337547 TGTTCTCTGGATGTTCTCCAGGG - Intergenic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1169392576 20:5202497-5202519 TGTGCTGTGGAGGAACTGCAGGG + Intergenic
1169523595 20:6399556-6399578 TGATCACTGGAGGCTGGGCATGG + Intergenic
1171427021 20:25055555-25055577 TGTCCTCTGGAGCATCTGAAGGG + Intronic
1173318824 20:41969239-41969261 TGTTCTACGGATCATGTGCATGG - Intergenic
1176253849 20:64140378-64140400 TGTTGTCTGGAGGCTTTGCCTGG + Intergenic
1176515908 21:7783265-7783287 TGTTCTCTGGAGGGAGGGAATGG - Intergenic
1177280505 21:18976054-18976076 TATTTTCTGGAGGAAGTGCTAGG - Intergenic
1178587145 21:33880079-33880101 TGTTGTCTTGATGATGTTCATGG + Intronic
1178649936 21:34413277-34413299 TGTTCTCTGGAGGGAGGGAATGG - Intergenic
1180197589 21:46206967-46206989 TGTTCCCTGGTGGCTGTGCATGG - Intronic
1180692924 22:17732423-17732445 TGTTCTCAGGGGTATTTGCAAGG + Intergenic
1181142913 22:20820560-20820582 TGTCCTCTTGGGGATGTGCCAGG - Exonic
1182009729 22:26990348-26990370 TCTCCTCTGGAGGGTGTGAAAGG - Intergenic
1183297926 22:37043133-37043155 TGTCCCATGGAGGAGGTGCATGG + Intergenic
1183879329 22:40813424-40813446 GGTACTCTGGAGGATGTGGCAGG + Intronic
1184813670 22:46854390-46854412 TGTTCAGTGGAGGAGGAGCAGGG - Intronic
1185179448 22:49350636-49350658 GGTGCCCTGGAGGATGTGGAGGG - Intergenic
949879045 3:8647697-8647719 TGGTTCCTGGTGGATGTGCAGGG - Intronic
949981152 3:9502385-9502407 TGTGCCCTGGGGAATGTGCAAGG - Intronic
953097056 3:39788493-39788515 TGTGCTCTGTAAAATGTGCAAGG + Intergenic
954653999 3:52182745-52182767 GGTGCTCTTGAGGATTTGCAGGG + Intergenic
955388225 3:58497203-58497225 TGTGCTTTGAAGGATTTGCAAGG + Intronic
955727813 3:61951663-61951685 TGTTTTTTGGGGAATGTGCAAGG + Intronic
956615392 3:71166147-71166169 TTTTCTGTGTAGTATGTGCAGGG + Intronic
957490704 3:80923259-80923281 TGTTCTCTCCAGGATGGGCTTGG - Intergenic
959341875 3:105142059-105142081 TTTTCTCTTGAGAATGTGCTGGG - Intergenic
959398395 3:105869169-105869191 TGTACTGTGGAGGACGTGGACGG - Intronic
961140394 3:124551039-124551061 TGTTCCCTTGAACATGTGCATGG - Intronic
961314049 3:126022457-126022479 TGTGGTCTGGAGGTGGTGCAGGG + Intronic
961562528 3:127740582-127740604 AGTTCTGTGGGGGTTGTGCAGGG + Intronic
961885462 3:130093938-130093960 TGTGCTCTGGAGGCTGTGGCAGG + Intronic
963497670 3:146087872-146087894 TATTCTCTGGACAATGTGAATGG + Intronic
963529801 3:146460704-146460726 TGTTTTCAGGAGGATGTTCTGGG - Intronic
963878726 3:150504200-150504222 TTTTCTCAGGTGGAGGTGCATGG - Intergenic
968994666 4:3938130-3938152 TGTGCTCTGGAGGCTGTGGCAGG + Intergenic
968994678 4:3938179-3938201 TGTGCTCTGGGGGCTGTGCCAGG + Intergenic
969759320 4:9170614-9170636 TGTGCTCTGGGGGCTGTGCCAGG - Intronic
969759332 4:9170663-9170685 TGTGCTCTGGAGGCTGTGGCAGG - Intronic
969819283 4:9708094-9708116 TGTGCTCTGGAGGCTGTGTCAGG - Intergenic
972181712 4:36475033-36475055 TGATCTTTGGAGGATCTCCAGGG + Intergenic
972704806 4:41531813-41531835 TGTTCTCTGTAGTAGTTGCATGG + Intronic
976236116 4:82899557-82899579 TGGTCCCTGGGGGATGTGCAGGG - Intronic
976344158 4:83980448-83980470 TGTACTCTGGATGATCTACATGG + Intergenic
976572860 4:86633412-86633434 TGTTCTCTGGAGTTAGTGGAGGG - Intronic
978061379 4:104344633-104344655 TGTGCACTGGAGCATGTGCCAGG - Intergenic
979695899 4:123612629-123612651 TGTTCTTTGGAGTATGTGGTAGG - Intergenic
980471817 4:133262864-133262886 GATTCTCTGGAGGGGGTGCACGG + Intergenic
980616777 4:135238059-135238081 TGTTCTCTTTAGGATCTTCAAGG + Intergenic
981618711 4:146669924-146669946 TCTACTCTGGAGGATGAGGAAGG - Intergenic
983488576 4:168361201-168361223 TGTTCTCTTTAGGATGCGTATGG - Exonic
984364300 4:178778271-178778293 TGATTCCTGCAGGATGTGCAAGG + Intergenic
987035647 5:14015587-14015609 TTTTCTCAGGAGGCTGGGCATGG - Intergenic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
988630719 5:32928485-32928507 TGTTCTTTGGAGGAATTGAAGGG - Intergenic
990542969 5:56793018-56793040 TGTTCTCAGGAAGGTGTGCAAGG - Intergenic
991965518 5:72086554-72086576 TGCTCTTTGGAGGCTGTGCAAGG - Intergenic
993333425 5:86627695-86627717 TTTTTTTTGGAGGATGTGAAGGG - Intergenic
995861517 5:116645847-116645869 ATTTTTCAGGAGGATGTGCATGG - Intergenic
995928484 5:117406182-117406204 TCCTCTCTGGAGAATGTGCTAGG - Intergenic
997679304 5:135738104-135738126 TGTTCCCTGAAGGAAGGGCATGG - Intergenic
997900454 5:137759007-137759029 CTTTTTCAGGAGGATGTGCAGGG - Intergenic
998314088 5:141164441-141164463 GTTTCTTTGTAGGATGTGCATGG + Intergenic
1001688243 5:173612060-173612082 TGTTCTCTGGAGAAAGGGAAAGG + Intronic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002214387 5:177619565-177619587 TGTTCCCAGGAGGCTTTGCATGG - Intergenic
1010404027 6:75482163-75482185 TATTCCCTGGAAGATGTGAATGG + Intronic
1012206668 6:96469505-96469527 TGTTCTCTTGAAGATGTGTATGG - Intergenic
1012554170 6:100491515-100491537 GGTTCTCTGAAGGGTTTGCAGGG - Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1013994533 6:116292954-116292976 TGATCTCTGGGGGATGAGGATGG + Intronic
1014199304 6:118590727-118590749 TGTTTTCTGGGGTAGGTGCATGG - Intronic
1014826740 6:126055595-126055617 TGTTCTCTGGATGACGTACTGGG + Intergenic
1015555434 6:134456473-134456495 TGTTCTCTGCAAAATGGGCAGGG + Intergenic
1018454743 6:163941683-163941705 TGTTCCCTAGAGGATTTGAAGGG - Intergenic
1018465711 6:164042766-164042788 TGTTCTTTTGAGAATGTGCCTGG - Intergenic
1018918589 6:168154746-168154768 TGGTCACTGGGGGATTTGCATGG + Intergenic
1019017617 6:168891284-168891306 TATTCTCTGGAGACAGTGCAAGG + Intergenic
1020318939 7:6926502-6926524 TGTGCTCTGGAGGCTGTGGCAGG + Intergenic
1021973412 7:25986858-25986880 CTTTCTCTGGAGGAAGTGCCAGG - Intergenic
1023185445 7:37528490-37528512 TGTTCTCAGGAGGTAGTGAAGGG + Intergenic
1023884656 7:44345134-44345156 TGGTCTCTGGAGGAAGTTAATGG - Intergenic
1026769717 7:73187932-73187954 AGTTGGCTGGAGGAGGTGCAGGG + Intergenic
1027010585 7:74741314-74741336 AGTTGGCTGGAGGAGGTGCAGGG + Intronic
1027077457 7:75204726-75204748 AGTTGGCTGGAGGAGGTGCAGGG - Intergenic
1027870393 7:83699531-83699553 TGTTCTTGGGAGGATGGTCATGG - Intergenic
1029509102 7:100982155-100982177 TGTGCCCTGGAGGCTGGGCACGG - Intronic
1029676194 7:102070696-102070718 TCTTCTCTGCAGTACGTGCAGGG - Intronic
1029813659 7:103073632-103073654 TGTGTTCAGGAGGATGTACAAGG - Intronic
1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG + Intergenic
1036381479 8:8238694-8238716 TGTGCTCTGGAGGCTGTGGCAGG - Intergenic
1036847193 8:12178347-12178369 TGTGCTCTGGGGGCTGTGCCAGG + Intergenic
1036868560 8:12420668-12420690 TGTGCTCTGGGGGCTGTGCCAGG + Intergenic
1037803137 8:22045781-22045803 TATTCTATGAAGGAGGTGCACGG - Intronic
1038198221 8:25387608-25387630 TGTTCACTGGAGGTTCTGGAAGG - Intronic
1038664944 8:29529836-29529858 CGTTCTCTGGTGGCTGTGCTGGG + Intergenic
1039731874 8:40288452-40288474 TGTCCTCTGGAGGATCTGAGGGG + Intergenic
1041716188 8:60934539-60934561 TGTTCTGGGGAGGATGTCCTAGG - Intergenic
1042201688 8:66284990-66285012 TGTCTTCTGGAGGATGTTGAGGG - Intergenic
1042857417 8:73281761-73281783 TATTCTCTGGAGGAGGAGCCAGG - Intergenic
1043520029 8:81034973-81034995 TGTTCCTTGGAGGTTGTGCTTGG - Intronic
1049221772 8:141431801-141431823 TGTCCTCTGCAGGATGGGCTGGG + Exonic
1050090435 9:2013119-2013141 TGTTTTTTTGAGGATTTGCATGG + Intergenic
1050525936 9:6546515-6546537 TGTCCTCTGGAAGGTGTTCAGGG + Intronic
1053164668 9:35835956-35835978 TGTTCACTGGAGGAGAAGCAGGG + Intronic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1057125286 9:92611568-92611590 GGAGCTCTGGAGGATGTGCTGGG + Intronic
1057743216 9:97730454-97730476 GGTTCCCTGGTGGGTGTGCAGGG - Intergenic
1058421807 9:104839998-104840020 GGTTTTCTGGGGGATGTGGAAGG - Intronic
1059153159 9:111967130-111967152 TCTTCTCTGCAGGATCTGCTGGG - Intergenic
1061444600 9:130630829-130630851 TGTTTTCTTGTGGATGTCCAAGG + Intronic
1061796656 9:133089325-133089347 TGTTCTCTGGCTTATGTGAACGG - Intergenic
1188546195 X:31310099-31310121 TATTCCCTGGGGGATGTGAAGGG - Intronic
1191936602 X:66434008-66434030 TGTCCACTGGATGCTGTGCAAGG - Intergenic
1192165285 X:68824039-68824061 GGTTACCTGGAGAATGTGCAAGG - Intergenic
1200119504 X:153783664-153783686 TCTTCCCTGGCGGCTGTGCAGGG + Intronic