ID: 1139402773

View in Genome Browser
Species Human (GRCh38)
Location 16:66696066-66696088
Sequence CGAGGGCGGAGCGGACAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139402758_1139402773 18 Left 1139402758 16:66696025-66696047 CCAGCAGCACCCAGCCCAGTAAC 0: 1
1: 0
2: 6
3: 43
4: 356
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139402766_1139402773 -6 Left 1139402766 16:66696049-66696071 CCACAGACTCCCGGGAGCGAGGG 0: 1
1: 0
2: 0
3: 15
4: 328
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139402761_1139402773 4 Left 1139402761 16:66696039-66696061 CCCAGTAACGCCACAGACTCCCG 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139402757_1139402773 19 Left 1139402757 16:66696024-66696046 CCCAGCAGCACCCAGCCCAGTAA 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139402762_1139402773 3 Left 1139402762 16:66696040-66696062 CCAGTAACGCCACAGACTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139402759_1139402773 9 Left 1139402759 16:66696034-66696056 CCCAGCCCAGTAACGCCACAGAC 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139402760_1139402773 8 Left 1139402760 16:66696035-66696057 CCAGCCCAGTAACGCCACAGACT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139402773 Original CRISPR CGAGGGCGGAGCGGACAGGT AGG Intronic
900088265 1:908767-908789 GGAGGGATGAGGGGACAGGTGGG + Intergenic
900125891 1:1068839-1068861 CGAGGGCGGAGCCATCGGGTGGG + Intergenic
901811774 1:11771444-11771466 CTGGGGTGGGGCGGACAGGTTGG + Intronic
901857567 1:12054144-12054166 CGAGGGCAGAGGGGCCGGGTGGG + Intergenic
902837939 1:19058694-19058716 GGAGGACGGAGGGGACAGGACGG - Intergenic
915226936 1:154418536-154418558 AGAGGGGGTTGCGGACAGGTGGG + Intronic
919739685 1:200974212-200974234 CGAGGACAGAGAGGAGAGGTGGG + Intronic
1077185670 11:1234400-1234422 CCAGGGCGGAGCTTCCAGGTGGG - Intronic
1079242331 11:18729568-18729590 TGAGGGCCGAGGGGACCGGTGGG + Intronic
1091740886 12:2959694-2959716 GGAGCGCGGGGCGGACAGGAGGG - Intronic
1094147332 12:27244240-27244262 CGAGGGCGGAGCGGGGAGAAGGG + Exonic
1098963665 12:76764090-76764112 CGAGGGGGGAGGGGACAGAGGGG + Exonic
1101749354 12:107570751-107570773 AGGGGGAGGAGCAGACAGGTAGG - Intronic
1104353945 12:128068689-128068711 TGAGGGCGGAGCCGACATGACGG - Intergenic
1104946675 12:132417738-132417760 CGTGGGAGGAGGGGACAGGCAGG - Intergenic
1105217209 13:18295241-18295263 CCAGGGCTGACTGGACAGGTGGG - Intergenic
1106264868 13:28100686-28100708 CGAGGCGGGAGCGGAGAGGTTGG + Intergenic
1115911019 14:38256141-38256163 CGAGGGCGGAGGGGAAGGGAGGG - Exonic
1117131979 14:52695763-52695785 CGCGGGCGCAGCGGACCGGGCGG - Intronic
1119399242 14:74350393-74350415 CGAGGAGGGTGGGGACAGGTGGG + Intronic
1125181006 15:36880734-36880756 CCCGGGCGGAGGGAACAGGTGGG + Intergenic
1131174565 15:90201696-90201718 CGGGGGCTGAGCGCCCAGGTCGG - Exonic
1132692342 16:1187235-1187257 CGTGGGCAGAGCGGACAGGGAGG + Intronic
1132852944 16:2033051-2033073 CCAGGGCTGAGGGGACAGGGAGG - Intronic
1133187426 16:4109996-4110018 CCAGGGCAGAGCGGAGAGGTGGG - Intronic
1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG + Intronic
1139948948 16:70660087-70660109 CGGGGGCGGAGGGTACAGCTGGG - Exonic
1141690621 16:85594240-85594262 GGGGGGCGGAGGGGACAGGCGGG + Intergenic
1148127421 17:45244027-45244049 TGTGGGCGGAGCGGGCAGGGCGG + Intronic
1148441699 17:47714872-47714894 GGAGGGCTGAGGGGACAGGATGG + Intergenic
1151889514 17:76943860-76943882 GGAGGGAGGAGCGGCCAGGATGG + Intronic
1152332955 17:79684353-79684375 CGAGGGAGGAGAGGCCAGGCAGG + Intergenic
1152368827 17:79872472-79872494 CGAGAGGGGAGGGGACAGGAGGG - Intergenic
1157609699 18:48948840-48948862 CGAGTGCCGAGCGGACCGGCGGG - Intronic
1157675307 18:49564131-49564153 AGAGGGCGGAGGGGAAAGGAGGG - Intronic
1160594505 18:79964571-79964593 CGGGGCCGGAGCGGAGAGGCGGG - Exonic
1161003071 19:1920880-1920902 CGAGGGCCGAGGGGGCAGGGAGG - Intronic
1162577674 19:11508176-11508198 AGAGGGAGGAGGGGACAGGTTGG - Intronic
1164100728 19:22052443-22052465 CGAAGCTGGAGCGGACAGGGTGG + Intronic
1165105893 19:33469556-33469578 GGAGGGAGGAGAGGACAGATGGG - Intronic
1165816823 19:38647701-38647723 TGAGGCGGGAGCGGACAGGCTGG + Exonic
1167696226 19:51017035-51017057 CCAGGGAGGAGCGGGCAGGGCGG - Intronic
1168294065 19:55370265-55370287 GGAGGGTGGAGGGGACAGGGAGG - Intronic
925346300 2:3174545-3174567 CGAGGCCGGAGCTGAAAGGCAGG - Intergenic
932236562 2:70125244-70125266 GGAGGGCAGAGGGGACGGGTCGG + Intergenic
933778675 2:85787047-85787069 TGAGGGCGGAGGGGAGAGGGAGG - Exonic
934297115 2:91751442-91751464 CCAGGGCTGACTGGACAGGTGGG + Intergenic
936278474 2:111119739-111119761 CGCGGGAGGAGCAGACAGGAGGG + Intronic
937457364 2:122054192-122054214 AGAGGACGGAGGGGACAGGAGGG - Intergenic
939900417 2:147844297-147844319 CGAGGGCGGGGCGGAGTGGAGGG - Intergenic
946038786 2:216766114-216766136 CGAGTGCCGAGGGAACAGGTGGG + Intergenic
948560201 2:238847208-238847230 CGAAGGCGGAGCGCAGAGGCTGG + Intergenic
1175900700 20:62358889-62358911 GGAGGGCAGAGTGGACAGGTAGG - Intronic
1176209485 20:63911449-63911471 CCAGGGAGGAGCAGACAGGCAGG - Intronic
1180109832 21:45642749-45642771 GGCGGGCGGAGGGGACAGGGCGG + Intergenic
1180963565 22:19773849-19773871 TGAGGGCCGAGGGGCCAGGTGGG - Intronic
1183315215 22:37133293-37133315 TGTGGGCGGAGGGGACGGGTGGG + Intronic
1183728711 22:39604997-39605019 CGTGGGTGGAGAGGACAGGATGG + Intronic
1183740165 22:39664684-39664706 CGCGGGAGGGGCGGGCAGGTGGG - Intronic
1184465711 22:44668270-44668292 CGCGGGCGGAGCGGGGAGGGAGG - Intergenic
1184692368 22:46123117-46123139 AGAGGGCGGTGCTGACAGGAGGG - Intergenic
950518348 3:13481436-13481458 TGAGGACGGAGAGGACAGGTGGG - Intronic
950898326 3:16473850-16473872 CGAGGGCAGCCCGGAGAGGTAGG - Intronic
954131422 3:48563027-48563049 TGAGGGCGGAGCTGGAAGGTTGG + Exonic
954437473 3:50503676-50503698 AGAGGGCGGTGCCGGCAGGTTGG - Intronic
954912733 3:54122514-54122536 GGAGGGCGGAGAGGAGAGGGAGG - Intergenic
961013591 3:123450440-123450462 CCGGGGCGGGGCGGACAGGGAGG + Intergenic
961654482 3:128433578-128433600 CCAGGGCAGAGAGGACTGGTGGG + Intergenic
962301811 3:134250386-134250408 CGAGGCCGGGGCGGGCAGGTCGG - Intronic
967849213 3:194070112-194070134 GAAGGGAGGAGAGGACAGGTAGG + Intergenic
968965569 4:3767548-3767570 CGCGGGCGGTGCGGACGGGCAGG + Exonic
976389848 4:84496981-84497003 CGAGGGCGAAGAGGTGAGGTGGG + Intronic
985533637 5:448737-448759 GGAGGGCAGAGAGGACAGGGTGG - Intronic
986707555 5:10464078-10464100 CGAGGACGGCTGGGACAGGTGGG - Intronic
998408043 5:141885453-141885475 CAAGGACAGAGCAGACAGGTAGG - Intergenic
1001423022 5:171601238-171601260 CCAGGGCGGAGGGGGCAGGAGGG + Intergenic
1002602209 5:180360485-180360507 CGAGGGCGCAGCGTGGAGGTGGG + Intergenic
1003948289 6:11094533-11094555 CTAGGGCTGAGCGCAGAGGTGGG + Intronic
1005987902 6:30885457-30885479 CGAGGGGGCAGGGAACAGGTGGG - Intronic
1007228089 6:40328781-40328803 AAAGGGAGGAGAGGACAGGTGGG - Intergenic
1010752612 6:79631662-79631684 AGAGGGCGGGGAGGAAAGGTGGG + Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1014802454 6:125791333-125791355 CGAGAGTGGGGAGGACAGGTTGG + Intronic
1018938848 6:168294383-168294405 CGTGGGCGGAGCGTGCACGTGGG + Intronic
1019614596 7:1953397-1953419 CCAGGGAGGAGCAGGCAGGTGGG + Intronic
1033033161 7:137846592-137846614 CGAGGGCGGCGCGGACCCGCGGG - Exonic
1035022249 7:155806658-155806680 CGAGGGCCATGCGGAGAGGTGGG + Intronic
1040513697 8:48117414-48117436 CGAGGGAGGACCGCACAGGCAGG - Intergenic
1041859640 8:62498395-62498417 AGAGGGTGGAGCTGAAAGGTAGG - Intronic
1045112185 8:98946750-98946772 GGAGGGGGGAGCGGGCATGTGGG - Intronic
1046467200 8:114620930-114620952 GGAGGGAGGAGCGGAGAGATGGG - Intergenic
1047766529 8:127994386-127994408 CAAGGGCAGAGAGGACAGGAGGG - Intergenic
1049786226 8:144452095-144452117 CCAGGGTGGCGAGGACAGGTGGG + Intronic
1052837826 9:33264755-33264777 CGAGGGCGGGGCCGGCAGGCCGG - Exonic
1057139547 9:92718341-92718363 GGAGGGTGGAGCAGGCAGGTGGG - Intronic
1062188156 9:135229563-135229585 CGAGGGCAGACAGGGCAGGTGGG + Intergenic
1185459820 X:328849-328871 GGAGGGGGGAGGGGAGAGGTGGG - Intergenic
1192344496 X:70290007-70290029 CGAGGGCGGAGCGCGCACGTCGG - Intronic
1192358200 X:70422991-70423013 CGAGGGCTGAGGGCACAGGCTGG - Intergenic