ID: 1139402888

View in Genome Browser
Species Human (GRCh38)
Location 16:66696451-66696473
Sequence GCTGCTGGCGCCCGAGATCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139402874_1139402888 27 Left 1139402874 16:66696401-66696423 CCGGCCAGCCCGCGGCGCTGGCT 0: 1
1: 0
2: 4
3: 18
4: 205
Right 1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG 0: 1
1: 0
2: 0
3: 1
4: 114
1139402878_1139402888 18 Left 1139402878 16:66696410-66696432 CCGCGGCGCTGGCTCACCGGCTC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG 0: 1
1: 0
2: 0
3: 1
4: 114
1139402877_1139402888 19 Left 1139402877 16:66696409-66696431 CCCGCGGCGCTGGCTCACCGGCT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG 0: 1
1: 0
2: 0
3: 1
4: 114
1139402875_1139402888 23 Left 1139402875 16:66696405-66696427 CCAGCCCGCGGCGCTGGCTCACC 0: 1
1: 0
2: 1
3: 28
4: 274
Right 1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG 0: 1
1: 0
2: 0
3: 1
4: 114
1139402884_1139402888 2 Left 1139402884 16:66696426-66696448 CCGGCTCGGTGGTGGGCTGGTAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG 0: 1
1: 0
2: 0
3: 1
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139402888 Original CRISPR GCTGCTGGCGCCCGAGATCA TGG Exonic
900408520 1:2502743-2502765 GCTGCTGGAGTCCGAGGACATGG - Intronic
901649814 1:10737110-10737132 GCTGCTGGGGCCACAGACCAAGG + Intronic
904590069 1:31608597-31608619 GCTGCTGGCGGCCGACAGGATGG + Intergenic
906690452 1:47789378-47789400 TCTGCTGGGGACCGAGATTAGGG - Intronic
922348053 1:224713438-224713460 GCTGCTGGTACCAGAGGTCAGGG + Intronic
922746499 1:228047248-228047270 GCTGCTGGGACCCGCCATCAGGG + Intronic
922783295 1:228269904-228269926 GCTCTTGGCGCCCGGGGTCAGGG + Intronic
922819887 1:228476923-228476945 GAGGCTGGAGTCCGAGATCAAGG - Intergenic
923914976 1:238491944-238491966 GCAGCTGGAGACAGAGATCAAGG + Intergenic
1063126936 10:3143668-3143690 GGTGCTGGGGCGCGAGAGCAAGG + Intronic
1069714593 10:70512579-70512601 GCTGCTGAGGCCCGAGGGCAAGG + Intronic
1076096676 10:127738619-127738641 GCTCCTGGCTCCCGAGCGCACGG - Exonic
1076554245 10:131311668-131311690 GCGGCGGGCGCCCGAGATGCTGG + Exonic
1077212352 11:1377339-1377361 GAGGCTGGAGCCGGAGATCAAGG - Intergenic
1077398910 11:2343153-2343175 GCGGCTGGAGTCCAAGATCAAGG + Intergenic
1077899408 11:6477262-6477284 CCTGCTGGACCCCCAGATCAAGG - Exonic
1078161767 11:8846351-8846373 GCTGCTGGCCCTAGAGGTCAGGG + Intronic
1083888649 11:65584994-65585016 GCTGCTGGAGCCCGCGGACATGG + Exonic
1084112585 11:67023505-67023527 GCTGCGTGCGTCCGCGATCAGGG - Intronic
1084521223 11:69664231-69664253 GAGGCTGGAGTCCGAGATCAAGG - Intronic
1084710995 11:70843667-70843689 GAGGCTGGAGCTCGAGATCAAGG - Intronic
1092511365 12:9160341-9160363 GCAGCTGACGCAGGAGATCAAGG - Exonic
1092523012 12:9292616-9292638 GAGGCTGGAGTCCGAGATCAAGG + Intergenic
1092544279 12:9439281-9439303 GAGGCTGGAGTCCGAGATCAAGG - Intergenic
1094508668 12:31082786-31082808 GAGGCTGGAGTCCGAGATCAAGG + Intronic
1096771173 12:53936899-53936921 GCTGCTGGAGTCCAAGGTCAAGG - Intergenic
1101865560 12:108517242-108517264 GCTGCTGGTGGCCAAGACCAAGG + Exonic
1103407703 12:120687356-120687378 GCTGCTGCCGCCGGCGATCCGGG + Exonic
1109287390 13:60426036-60426058 GCTGCTAACACCCGAGTTCAAGG + Intronic
1111589240 13:90322588-90322610 GCTGCTGTCCCTGGAGATCAAGG - Intergenic
1113800492 13:113083816-113083838 CCTGCTGGCGCCTGAGAGCTTGG + Intronic
1117222424 14:53619418-53619440 GCTTCTGGTGCCTGAGATAAAGG + Intergenic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1121729097 14:96173921-96173943 GCTGGTGGCGCCTGGGCTCAGGG + Intergenic
1123153338 14:106203077-106203099 GCTCCTGGGGGCCGAGAGCAAGG + Intergenic
1127459030 15:59181050-59181072 GCTGCTGGCACTTGAGATTAAGG + Intronic
1132591557 16:728413-728435 GCTGCGGGTACCCGAGAACAGGG - Exonic
1132613812 16:830650-830672 GCTGCAGGAGCCTGAGATCGGGG + Intergenic
1132971597 16:2691895-2691917 GCTGCTGGCCCCTGAGCACAGGG + Intronic
1136658610 16:31732186-31732208 CCAGCTGGAGCCCAAGATCAAGG - Intronic
1139402888 16:66696451-66696473 GCTGCTGGCGCCCGAGATCATGG + Exonic
1140181967 16:72729205-72729227 GCAGCTGGAGACAGAGATCAAGG + Intergenic
1141148652 16:81549391-81549413 GCTGCTGGCTCCTGACCTCATGG - Intronic
1141393315 16:83682597-83682619 GCTGCTGTGTCCCGAGAACACGG + Intronic
1142815370 17:2420826-2420848 GGTGCTGGCGTCCGTGATGAAGG - Exonic
1147666586 17:42152694-42152716 GCCTCTGCCTCCCGAGATCAAGG - Intronic
1149045146 17:52236461-52236483 GCTGCAGTGACCCGAGATCATGG - Intergenic
1155003281 18:21706539-21706561 GCTGCTGTGCCCCGCGATCACGG + Intronic
1162549543 19:11350977-11350999 GCTGCTGGCCCAGGAGATCCGGG + Exonic
1163315655 19:16538890-16538912 GCAACTGGCGCCCAAGTTCATGG + Intronic
1163711666 19:18850811-18850833 GCTGCGGGCACGCCAGATCACGG + Exonic
1167314023 19:48753409-48753431 GCTGCCGGCGCCAGAGACAAAGG + Exonic
1167610658 19:50506397-50506419 GCTGCGGGCGCCCGAGGCCCTGG - Exonic
1168127013 19:54289869-54289891 GATGCTGGCGCCCACCATCAAGG + Intergenic
1168173437 19:54606591-54606613 GATGCTGGCGCCCACCATCAAGG - Intronic
925193937 2:1908330-1908352 TGTGCTGGCCCCCGAGAGCAGGG + Intronic
927684490 2:25161236-25161258 GCTGGTGGCGGCCGAGAAGAAGG - Exonic
930773545 2:55151019-55151041 GCTGCTGGCAGCAGAGACCAAGG + Intergenic
932627257 2:73307778-73307800 GCTGCTGGCGCCCAACAGCTGGG - Intergenic
934502099 2:94869784-94869806 GCTCCTGGGGCCACAGATCAGGG + Intergenic
937138346 2:119575308-119575330 GTGGCTGGGGCCCGAGAACACGG - Intronic
941125693 2:161580658-161580680 GCAGCTGGAGGCAGAGATCAAGG + Intronic
941580728 2:167293216-167293238 GATGCTGGCGCCGGGGATCGGGG + Intergenic
942773759 2:179555400-179555422 GTAGCTGGCCCCCCAGATCAAGG - Intronic
944457614 2:199911533-199911555 GCCGCTGCCGCCCGGGTTCATGG - Exonic
947398991 2:229714151-229714173 GCAGTTGGCGCCGGAGATCCCGG + Exonic
948575272 2:238945899-238945921 GCTGGTGGCACCAGAGAGCAAGG - Intergenic
1168772188 20:422214-422236 GCTGCTGGAGAGGGAGATCAAGG + Exonic
1172127601 20:32634184-32634206 GCTGCTGGGGCTTGAGTTCAGGG + Intergenic
1173519998 20:43692262-43692284 GCTGCTGGAGCTCGAGGACAAGG + Exonic
1174651006 20:52125564-52125586 GCTGCTGCCACCCAAGACCAAGG - Intronic
1176234501 20:64048199-64048221 GCTGCTGGCGTCCGACAGCGCGG + Exonic
1180733845 22:18001314-18001336 CCTGCTCGCGCCCGAGCTCGGGG - Intronic
1183403884 22:37620414-37620436 GCCGCTGGAGCCCCAGCTCATGG - Intronic
1184448349 22:44567550-44567572 GCAGCTGGAGACAGAGATCAAGG + Intergenic
1184857378 22:47153810-47153832 AGTGCTGTCGCCAGAGATCAAGG + Intronic
1185302571 22:50090160-50090182 GCAGCTGGAGCCCGAGCTCGCGG + Exonic
950261103 3:11543923-11543945 GCTGCTGGCAGCAGACATCAAGG + Intronic
950266080 3:11574095-11574117 GTTCCTGGTGCCTGAGATCAAGG - Intronic
961306153 3:125959932-125959954 CCTGCTGGCCCCTGAGGTCACGG + Intergenic
966023409 3:175244116-175244138 GCTGATTGCTCCCGAGATAAGGG - Intronic
969220857 4:5757521-5757543 GAGGCTGAAGCCCGAGATCACGG + Intronic
969716722 4:8871524-8871546 CCTGCTGGCGGCCGAGGCCAAGG - Exonic
969963039 4:10965402-10965424 GCTGCTGGGCCTCGAGAGCATGG + Intergenic
974023535 4:56712134-56712156 ACTGCAGGCGCCAGAGAACATGG - Intergenic
986644379 5:9902340-9902362 GCTGCTGTCTCCCCAGATCCTGG + Intergenic
987050347 5:14143370-14143392 GCCGCCGGCGCCCGTGATCCCGG + Intergenic
990374487 5:55155691-55155713 GCTGCTGGCGATAGAGATAAAGG - Intronic
994619891 5:102150560-102150582 GGTTCTGGCGTCCAAGATCAAGG + Intergenic
998184337 5:139967166-139967188 GGTGCTGGGGCCAGGGATCATGG + Intronic
999768110 5:154755844-154755866 GCCGCCGGCGCCCGAGGGCAAGG + Intronic
1002160519 5:177311776-177311798 GCTGCAGGCGGCCGAGTTCCTGG - Exonic
1006465298 6:34190368-34190390 GCAGCTGGAGACAGAGATCAAGG + Intergenic
1015654049 6:135497475-135497497 GCTGCTGGAGTCCGAGAGCGCGG - Intronic
1019522153 7:1465903-1465925 ACTGCTGGCGCCCCAGCTCCGGG - Intergenic
1019672836 7:2291534-2291556 GCTGCAGGGAGCCGAGATCATGG + Intronic
1019708403 7:2507307-2507329 GCTGCTGGCTCCCTCGCTCAGGG - Intergenic
1023677707 7:42647834-42647856 GCTGCCAGGGCCCCAGATCAGGG - Intergenic
1023820008 7:43975324-43975346 GCTGCTGGGGCCAGAGATGTGGG + Intergenic
1024255034 7:47534210-47534232 GCTGCAGTAGGCCGAGATCATGG + Intronic
1029748284 7:102528777-102528799 GCTGCTGGGGCCAGAGATGTGGG + Intergenic
1029766231 7:102627864-102627886 GCTGCTGGGGCCAGAGATGTGGG + Intronic
1031786451 7:126040398-126040420 GCTCCTGGCCCCCAAGAGCACGG - Intergenic
1032787352 7:135211403-135211425 GCAGCTGGACGCCGAGATCAAGG - Exonic
1035615413 8:996444-996466 GCTGCTGGCTCCCGTGCTGAAGG + Intergenic
1036578986 8:10054986-10055008 GCCGCGGGCGCCCGCGAGCAAGG - Intronic
1038423966 8:27452722-27452744 GCTGCTGTCTCCCCAGGTCAGGG + Intronic
1039843334 8:41308898-41308920 CCTGCTGGAGCACGAGACCATGG - Exonic
1042653689 8:71070843-71070865 GCTTCTGGAGGCTGAGATCAGGG - Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1053054691 9:34987699-34987721 GCTGCTGGCTCCTCAGATCTGGG - Intergenic
1053142061 9:35688651-35688673 GCTGCTGAAGCCAGAGGTCAAGG + Intronic
1062323030 9:135999619-135999641 GATGCTGGCGCCTGAGATCTGGG - Intergenic
1191851374 X:65588490-65588512 GCTGCTGCCCCCGGAGCTCATGG - Intronic
1192446382 X:71214607-71214629 CCTGCTGGCACCTGAGGTCAAGG - Intergenic
1198479812 X:137031105-137031127 GGGGCTGGCCCCCCAGATCATGG + Exonic