ID: 1139403066

View in Genome Browser
Species Human (GRCh38)
Location 16:66697007-66697029
Sequence GGGTTCAGGCAGCGGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139403052_1139403066 17 Left 1139403052 16:66696967-66696989 CCGCTGGTGGGCGCTGGCGATCC No data
Right 1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG No data
1139403061_1139403066 -5 Left 1139403061 16:66696989-66697011 CCGGCACGCGGGGCGATGGGGTT No data
Right 1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG No data
1139403060_1139403066 -4 Left 1139403060 16:66696988-66697010 CCCGGCACGCGGGGCGATGGGGT No data
Right 1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG No data
1139403049_1139403066 29 Left 1139403049 16:66696955-66696977 CCGGGGCGGGAGCCGCTGGTGGG No data
Right 1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139403066 Original CRISPR GGGTTCAGGCAGCGGGGTCT TGG Intergenic
No off target data available for this crispr