ID: 1139405696

View in Genome Browser
Species Human (GRCh38)
Location 16:66716035-66716057
Sequence ATTTAAAGTTCTGCTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139405696_1139405697 0 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405697 16:66716058-66716080 AGTTCTTTGAAGATCCTGCTTGG No data
1139405696_1139405702 15 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405702 16:66716073-66716095 CTGCTTGGGTGAGATTTGTGGGG No data
1139405696_1139405705 23 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405705 16:66716081-66716103 GTGAGATTTGTGGGGAGGCAGGG No data
1139405696_1139405707 28 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405707 16:66716086-66716108 ATTTGTGGGGAGGCAGGGCAGGG No data
1139405696_1139405699 13 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405699 16:66716071-66716093 TCCTGCTTGGGTGAGATTTGTGG No data
1139405696_1139405701 14 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405701 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
1139405696_1139405706 27 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405706 16:66716085-66716107 GATTTGTGGGGAGGCAGGGCAGG No data
1139405696_1139405703 18 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405703 16:66716076-66716098 CTTGGGTGAGATTTGTGGGGAGG No data
1139405696_1139405698 1 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405698 16:66716059-66716081 GTTCTTTGAAGATCCTGCTTGGG No data
1139405696_1139405704 22 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405704 16:66716080-66716102 GGTGAGATTTGTGGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139405696 Original CRISPR ATTTAAAGTTCTGCTAGAAA AGG (reversed) Intergenic