ID: 1139405700

View in Genome Browser
Species Human (GRCh38)
Location 16:66716072-66716094
Sequence CCCACAAATCTCACCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139405700_1139405707 -9 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405707 16:66716086-66716108 ATTTGTGGGGAGGCAGGGCAGGG No data
1139405700_1139405710 1 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405710 16:66716096-66716118 AGGCAGGGCAGGGAGGATGGAGG No data
1139405700_1139405711 20 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405711 16:66716115-66716137 GAGGAGCTTGATGATCACTTAGG No data
1139405700_1139405708 -6 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405708 16:66716089-66716111 TGTGGGGAGGCAGGGCAGGGAGG No data
1139405700_1139405709 -2 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405709 16:66716093-66716115 GGGAGGCAGGGCAGGGAGGATGG No data
1139405700_1139405706 -10 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405706 16:66716085-66716107 GATTTGTGGGGAGGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139405700 Original CRISPR CCCACAAATCTCACCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr