ID: 1139405702 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:66716073-66716095 |
Sequence | CTGCTTGGGTGAGATTTGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1139405696_1139405702 | 15 | Left | 1139405696 | 16:66716035-66716057 | CCTTTTCTAGCAGAACTTTAAAT | No data | ||
Right | 1139405702 | 16:66716073-66716095 | CTGCTTGGGTGAGATTTGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1139405702 | Original CRISPR | CTGCTTGGGTGAGATTTGTG GGG | Intergenic | ||