ID: 1139405702

View in Genome Browser
Species Human (GRCh38)
Location 16:66716073-66716095
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139405696_1139405702 15 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405702 16:66716073-66716095 CTGCTTGGGTGAGATTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139405702 Original CRISPR CTGCTTGGGTGAGATTTGTG GGG Intergenic
No off target data available for this crispr