ID: 1139405703

View in Genome Browser
Species Human (GRCh38)
Location 16:66716076-66716098
Sequence CTTGGGTGAGATTTGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139405696_1139405703 18 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405703 16:66716076-66716098 CTTGGGTGAGATTTGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139405703 Original CRISPR CTTGGGTGAGATTTGTGGGG AGG Intergenic
No off target data available for this crispr