ID: 1139405706

View in Genome Browser
Species Human (GRCh38)
Location 16:66716085-66716107
Sequence GATTTGTGGGGAGGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139405696_1139405706 27 Left 1139405696 16:66716035-66716057 CCTTTTCTAGCAGAACTTTAAAT No data
Right 1139405706 16:66716085-66716107 GATTTGTGGGGAGGCAGGGCAGG No data
1139405700_1139405706 -10 Left 1139405700 16:66716072-66716094 CCTGCTTGGGTGAGATTTGTGGG No data
Right 1139405706 16:66716085-66716107 GATTTGTGGGGAGGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139405706 Original CRISPR GATTTGTGGGGAGGCAGGGC AGG Intergenic
No off target data available for this crispr