ID: 1139407585

View in Genome Browser
Species Human (GRCh38)
Location 16:66731260-66731282
Sequence AGCCCTGTGAGAGGTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139407585 Original CRISPR AGCCCTGTGAGAGGTGTGTT TGG (reversed) Intronic
901221267 1:7585336-7585358 AGCCCTGAGAGCGGTGGGATGGG + Intronic
902690249 1:18106630-18106652 AGCCCTCTGAGAGGAGTGTAGGG - Intergenic
904560211 1:31391716-31391738 ACCCATGTGAGAGGTTTGCTTGG - Intergenic
905362808 1:37431929-37431951 AGCCCTGTGTGTGGTGTGTAAGG - Intergenic
907238087 1:53065004-53065026 AGCCATGTGGGAGGTGTGTGGGG - Intronic
907257372 1:53190253-53190275 ACCCCTGTCAGTGGCGTGTTAGG + Intergenic
909698563 1:78494082-78494104 AGTCCAGGGAGAGGTATGTTTGG + Intronic
910144755 1:84066892-84066914 AGCCCAGTGAGACCTGTGTTAGG - Intergenic
911577411 1:99594993-99595015 GGCCCTTTGATAGGTTTGTTTGG + Intergenic
912035003 1:105301493-105301515 AGCCCATTAAGAGCTGTGTTGGG - Intergenic
912507938 1:110169333-110169355 AGCCCTGTGTGATAGGTGTTGGG + Intronic
914941215 1:152024461-152024483 AACCTGGTGAGAGATGTGTTGGG - Intergenic
914984323 1:152443050-152443072 AGCCCTGTGGGAAGTGGGTTTGG + Intergenic
916674839 1:167056396-167056418 TGCCATGAGAGAGGTGTGTGGGG + Intronic
917127879 1:171706957-171706979 TGCCCTGTTAAACGTGTGTTTGG + Intronic
917991133 1:180380012-180380034 AGCACTTTGAGAGGTGAGGTAGG + Intronic
919321153 1:196040173-196040195 AGCCCTGTGAGATATGTGTAAGG - Intergenic
920747523 1:208643136-208643158 AGCTCTGTGAAAGATGTGTCGGG + Intergenic
921332049 1:214049313-214049335 GGGCCTGTCAGAGATGTGTTGGG + Intergenic
921559660 1:216641869-216641891 AGCACTGTGAGAGATGTTGTAGG - Intronic
921708684 1:218352035-218352057 GGCCCTGGGAGAGGTGTGCAGGG + Intronic
921939224 1:220823041-220823063 AGGGCTGGGGGAGGTGTGTTTGG - Intergenic
924941822 1:248817434-248817456 AGCCTTGTGAGGGGTGGGTGTGG + Intronic
1063257759 10:4347602-4347624 TGCTCTGTGATAGGTGTGTGTGG - Intergenic
1067044720 10:42978590-42978612 AGAACTGTGTGAGGTGTGTGTGG - Intergenic
1067693787 10:48520993-48521015 AGCTCTGTGATGGGTCTGTTTGG - Intronic
1068911268 10:62380971-62380993 AGTGCTGTGTGAGGTGTGTGGGG + Intronic
1069683367 10:70300760-70300782 AGTCCTGGGAGAGCTGTGGTGGG - Exonic
1073121562 10:101125232-101125254 AGCCCTTTGAGAGCTGTCTGGGG + Intronic
1073886925 10:108050107-108050129 AGCCCTGTGAGAGTAGGGATGGG + Intergenic
1075192425 10:120321951-120321973 AGCCCTGTAGGACCTGTGTTGGG + Intergenic
1076345804 10:129778271-129778293 AGCCCTGTGAGAGCTGCCTGGGG + Intergenic
1076819789 10:132932508-132932530 GGCCCTGTGTCAGGAGTGTTGGG - Intronic
1077721661 11:4636477-4636499 AGCAGTGTGAGGAGTGTGTTAGG - Intergenic
1079768982 11:24434281-24434303 AGCTCTGTGAGAGCTTTATTGGG - Intergenic
1080765804 11:35295791-35295813 AGCCCTGTGAGGGGCATCTTAGG - Intronic
1081413345 11:42785542-42785564 AGCCCTGTCAGGGCTGGGTTGGG + Intergenic
1081774958 11:45670578-45670600 AGCCTGGTGCCAGGTGTGTTGGG - Intergenic
1081979360 11:47257107-47257129 AGCCCTGTTTCAGGGGTGTTGGG + Intronic
1083883690 11:65560441-65560463 GGCCCTGGGAGAGATGTATTTGG + Intergenic
1083925645 11:65804373-65804395 AGCCCTGTAAGAGAGGTGGTAGG + Intergenic
1084080918 11:66824182-66824204 AGGCCTTTGAGAGGTGATTTAGG + Intronic
1087016089 11:93555760-93555782 AGCCCCGTGAGACTTGTGTAGGG - Intergenic
1087521431 11:99242285-99242307 AGGTCTGTGGGAGGTGTGTGAGG + Intronic
1089623846 11:119739040-119739062 AGCCCTGTGAGACGGGTGGGTGG + Intergenic
1089743337 11:120600111-120600133 AGCCCTGATTCAGGTGTGTTTGG + Intronic
1090104549 11:123838389-123838411 AGCCCGGTAAGATCTGTGTTGGG + Intergenic
1090267139 11:125360230-125360252 GGCCCTGTGGGAGGTGTGTGGGG + Intronic
1091402352 12:188812-188834 GTCCCTGTGAGAGGTGAGGTTGG + Intergenic
1092526962 12:9315290-9315312 AGCCCAGTGAGCTGTGTGTTAGG - Intergenic
1092540312 12:9416490-9416512 AGCCCAGTGAGCTGGGTGTTAGG + Intergenic
1094512737 12:31105986-31106008 AGCCCAGTGAGCTGGGTGTTAGG - Intergenic
1096072819 12:48784987-48785009 TGGCCTGTGCGGGGTGTGTTGGG - Intronic
1098576749 12:72051404-72051426 AGCACAGTGAGAGTGGTGTTGGG - Intronic
1100443530 12:94640259-94640281 AGCCCTGGGAGGGGTGAGGTGGG - Intronic
1102573668 12:113842902-113842924 AACTCTGTGGGAGGTGTGGTGGG + Intronic
1103616258 12:122154687-122154709 AGCGCTGGGAGAGTTCTGTTAGG - Intergenic
1103686393 12:122735296-122735318 AGCACTTTGAGAGGTGAGGTGGG + Intergenic
1103894144 12:124262071-124262093 GGCCCGGTGAGGGGTGTGTGAGG - Intronic
1105924226 13:24992391-24992413 AGCCCTATGTGAGCTGAGTTAGG + Intergenic
1112921236 13:104615198-104615220 AGGCCTGTGACTGGTGTGATTGG - Intergenic
1113443248 13:110346100-110346122 AGGCCAGTGAGAGGTGAATTTGG + Intronic
1114289048 14:21272762-21272784 AGCACTTTGGGAGGTGTGTCGGG - Intergenic
1114435038 14:22699249-22699271 AGTCCTGTGAGCAGTGTGTTTGG + Intergenic
1115262714 14:31470094-31470116 AGACTTGTGACTGGTGTGTTGGG + Intergenic
1115978632 14:39024300-39024322 AGCCATGTCAGAAGTGTGTATGG + Intergenic
1116039064 14:39663616-39663638 TGCCCAGTGTGGGGTGTGTTTGG + Intergenic
1116341029 14:43723247-43723269 AGTCCTGTGAAACCTGTGTTGGG + Intergenic
1116418163 14:44703454-44703476 GACCCTGTGAGGGATGTGTTTGG + Intergenic
1118229909 14:63938207-63938229 AGCACTTTGGGAGGTGAGTTGGG + Intronic
1121537351 14:94699984-94700006 AGCCCTGTGGGAGCTGAGCTTGG + Intergenic
1121811695 14:96896946-96896968 AACCCTGTGACAGGAGTGCTAGG + Intronic
1122297783 14:100714842-100714864 AGCCCTGTGGGAGGAGCCTTCGG + Intergenic
1123061482 14:105596683-105596705 GGCTCTGTGGGAGGTGTGTGTGG - Intergenic
1124168790 15:27353688-27353710 AGCACTTTGAGAGGTGAGGTGGG - Intronic
1125195550 15:37041927-37041949 AGCACTTTGAGAGGCCTGTTTGG + Intronic
1126187802 15:45847611-45847633 AGCCCAGTAAGAGGTGGTTTGGG + Intergenic
1126553304 15:49956791-49956813 AGCACTTTGAGAGGTGAGGTGGG - Intronic
1135849766 16:25952761-25952783 AGCCCTGTATGAGGCGGGTTTGG - Intronic
1136064473 16:27749534-27749556 AGCCCTGTGAGTGGCATGTGTGG - Intronic
1136790564 16:32965601-32965623 AGGCCAGTGACAGGTGTGGTGGG - Intergenic
1136879250 16:33888331-33888353 AGGCCAGTGACAGGTGTGGTGGG + Intergenic
1138148930 16:54637393-54637415 GGCCCTGAGGGAGGTGAGTTAGG + Intergenic
1139407585 16:66731260-66731282 AGCCCTGTGAGAGGTGTGTTTGG - Intronic
1142114175 16:88347856-88347878 AGTCCTGTGAGAGGTGTGCAGGG + Intergenic
1142308577 16:89299374-89299396 TGCCCTGTGTGGGGTGTGTGGGG + Intronic
1142308602 16:89299464-89299486 TGCCCTGTGTGGGGTGTGTGGGG + Intronic
1142308713 16:89299851-89299873 TGCCCTGTGTGGGGTGTGTGGGG + Intronic
1142308745 16:89299968-89299990 TGCCCTGTGTGGGGTGTGTGGGG + Intronic
1142308810 16:89300193-89300215 TGCCCTGTGTGGGGTGTGTGGGG + Intronic
1143717456 17:8785108-8785130 TGCCCTTGGAGAGGTGAGTTAGG - Intergenic
1144447523 17:15344713-15344735 AGCTGTGGGAGAGGTGTTTTTGG - Intergenic
1144698268 17:17320605-17320627 AATCCTGTGTGAGGTGTGTGAGG + Intronic
1144758515 17:17694437-17694459 AGCCCTCTGAGAGGTGGGCCAGG - Intronic
1148326412 17:46785812-46785834 AGCCCTGTGGGATGTTTCTTTGG + Intronic
1149125584 17:53226970-53226992 AGCCCTGTATTATGTGTGTTTGG + Intergenic
1150924918 17:69522806-69522828 AGCCCTTTGGGAGGTGGGGTGGG + Intronic
1151801798 17:76383517-76383539 AGCGATGAGAGAGGTGTGTGGGG + Intronic
1155403298 18:25461652-25461674 AGACCTGAGGGAGGTCTGTTGGG - Intergenic
1157525375 18:48376562-48376584 AGCCCTGAGAGAGGAGGGGTGGG - Intronic
1159087408 18:63809496-63809518 AGCGCAGTGAAAGGTGGGTTGGG + Intergenic
1160896246 19:1403387-1403409 AGCCCTGTGAGAGGGACGCTAGG - Intergenic
926811752 2:16760967-16760989 AGCCCTGTGAGATGTGACTCTGG + Intergenic
927692765 2:25219768-25219790 AGGCCTGTGAGAGGTGGACTGGG + Intergenic
931553037 2:63468269-63468291 AGCCATGTGAGAGATTTGTGGGG - Intronic
936288555 2:111200275-111200297 AGGCCTGTGTGTGGTGTGTCAGG + Intergenic
936955005 2:118014209-118014231 AGCCCGGGGAGAGGTGGGCTGGG + Intergenic
937040065 2:118814134-118814156 AGCTCTGTAAGGGGTGTGTGGGG - Intergenic
937595968 2:123673856-123673878 AGCCTTTTGAGATGTGTGTTAGG - Intergenic
947538091 2:230953557-230953579 AGCCCAGTGAGACTTGTGTTGGG + Intronic
947811332 2:233005749-233005771 AGCCCAGTGAGAGCCATGTTGGG + Intronic
947864610 2:233387737-233387759 AGGCCTGTGAGTGGTGGGTTGGG + Intronic
948310582 2:236982709-236982731 GGCCCTATGAGAGGAGTGGTGGG - Intergenic
1169480805 20:5978802-5978824 AGCACTTTGGGAGGTGTGGTGGG - Intronic
1169942394 20:10951242-10951264 AGTCCTGTGACAGTTGTTTTTGG + Intergenic
1172749580 20:37240988-37241010 TGCACTGTGAGAGGTGTGCCTGG + Intronic
1175401342 20:58701407-58701429 AGCCCTCTGAGAGGTGTCATGGG + Intronic
1176160022 20:63643031-63643053 GGCCCTGGGAGAGGTGGGTGTGG - Intronic
1177649838 21:23946231-23946253 AGGCATGTCAGAGGTGTGATGGG + Intergenic
1178843883 21:36158474-36158496 AGTCCTGTGAGATGGGTATTAGG - Intronic
1178934872 21:36852635-36852657 ACCCCTCTGAGAGGTGTGCTGGG - Intronic
1179643800 21:42763203-42763225 AACCCTGGGAGAAATGTGTTGGG + Intronic
1180936457 22:19628437-19628459 AGACGTGTGAAAGGTGTCTTTGG + Intergenic
1183658079 22:39202173-39202195 AGCACTTTGAGAGGTGAGGTGGG + Intergenic
952532306 3:34275127-34275149 AGCTCAGTGAGAGCTGGGTTGGG - Intergenic
953460657 3:43079259-43079281 AGCCCAGTGAAGGGTGTGTTTGG - Exonic
954397121 3:50298785-50298807 AGCCCTGTGAATGGTGTGGGAGG - Intronic
955110409 3:55943377-55943399 AGACCTCTGAGGTGTGTGTTTGG - Intronic
955620954 3:60863359-60863381 AGCCCAGTGAGACATGTATTGGG + Intronic
957260006 3:77888813-77888835 AGCCATGTGGGAAGTGAGTTTGG - Intergenic
958721027 3:97843687-97843709 TGCTCTGTGTTAGGTGTGTTTGG + Intronic
959356371 3:105334601-105334623 AGCCCTGTGAAAGCTGTGTTTGG - Intergenic
960050931 3:113238772-113238794 AGCCCTGTAAGGTGTGTGTATGG - Intronic
961207013 3:125092302-125092324 AGCCCTGGGAGATGTCTTTTAGG - Intronic
962889857 3:139662162-139662184 AGGCCTGGGAGAGTTGTGTCTGG - Intronic
964683553 3:159368788-159368810 AGGCTTGTGAGAGATGAGTTTGG + Intronic
965685709 3:171299923-171299945 ATCCCTGTGATAGGTGTTTCTGG - Intronic
967250376 3:187531475-187531497 GGCACTGTGATAGGTGTGGTGGG + Intergenic
968555789 4:1245841-1245863 GGCCCTGAGAGAGGTGTGGGCGG - Intronic
970650639 4:18174084-18174106 AGCCCTTTGAAAGGGCTGTTTGG + Intergenic
970975055 4:22034051-22034073 AGCCCTGTGGGATGTGATTTAGG - Intergenic
973029963 4:45325215-45325237 AGATCTGTGAGAGCTGTATTAGG - Intergenic
973787907 4:54351439-54351461 AGCCCTGTGAGGGGTTTATTAGG - Intergenic
975022065 4:69502385-69502407 ACACCTCTTAGAGGTGTGTTTGG + Intronic
979049549 4:115912038-115912060 AAATCTGTGTGAGGTGTGTTGGG + Intergenic
979671103 4:123361000-123361022 AGCCCTGACAGAGGTGGGTAAGG - Intergenic
981063334 4:140452091-140452113 AGCACTTTGAGAGGTGAGGTGGG + Intronic
981193921 4:141896140-141896162 AGCCCTGTAAGAGAAGTGGTTGG + Intergenic
981828195 4:148969192-148969214 AGCTTAGTGATAGGTGTGTTAGG + Intergenic
985202872 4:187502472-187502494 AGCCCTGAGAAAGGTGGGGTTGG - Intergenic
985635033 5:1031700-1031722 AGCCCTATAAGAGGCATGTTGGG + Intronic
986958816 5:13189312-13189334 AGCAAAGAGAGAGGTGTGTTAGG + Intergenic
990680148 5:58233572-58233594 AGCACTGTGAGTGGTGGGTTAGG + Intergenic
994055819 5:95413825-95413847 TGCCCTGTGAGAAGTTTGATAGG - Intronic
995491063 5:112692109-112692131 AGCTCTGTGAGAGGATTTTTGGG - Intergenic
995516923 5:112963458-112963480 AGCCCAGTGAGATCTGTGTTGGG + Intergenic
996780525 5:127181791-127181813 AACCCTGTGAAAGGTTTGCTGGG - Intergenic
998591599 5:143485014-143485036 AGCCCTTTGAGAGGTTTTTCAGG + Intergenic
999368132 5:151036106-151036128 TGCCCTGGCAGAGGTGGGTTGGG + Intronic
1000179232 5:158791653-158791675 AGCTCTGTGTTAGGTATGTTAGG - Intronic
1000372063 5:160546691-160546713 AGCCCCTTGAAAGCTGTGTTTGG + Intergenic
1001694260 5:173658368-173658390 AGCTCTGTGATAGGTATGTGGGG + Intergenic
1003060319 6:2857727-2857749 AGCCCTCAGAGAGGGGTGTGGGG - Intergenic
1003830188 6:10000934-10000956 AGCACTTTGTGAGGTGTGGTGGG + Intronic
1004388737 6:15191535-15191557 AGCCCTAGGAAAGGTGTCTTTGG - Intergenic
1005286677 6:24335270-24335292 TGCCCTGTGAGAAGTGAGATAGG + Intronic
1005676087 6:28156822-28156844 AGCCCTGGGAGAGGCATGTTAGG + Exonic
1005942299 6:30569612-30569634 AGCCCTGTGACAGGAGTGTTCGG - Intergenic
1007629470 6:43264834-43264856 AGCACAGGGACAGGTGTGTTGGG + Intronic
1011349633 6:86408330-86408352 AGCACTGTAAAATGTGTGTTTGG + Intergenic
1011821444 6:91257577-91257599 AGCCTTGTTAGAAGTGTGTTTGG + Intergenic
1012435551 6:99211616-99211638 AGCCCAGTGAGACCTGTGGTGGG - Intergenic
1013879497 6:114878490-114878512 AGCCCTGTAATAAGTATGTTTGG - Intergenic
1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG + Intergenic
1016308060 6:142703847-142703869 ACCCCAGTGAGAGCTGTGTGGGG + Intergenic
1019076656 6:169393571-169393593 TCCCATGTGAGAGGTGTTTTTGG - Intergenic
1019901646 7:4025842-4025864 AGCCCTGTCACATGTGAGTTAGG + Intronic
1022424963 7:30260068-30260090 GGCCCAGGAAGAGGTGTGTTTGG + Intergenic
1024201769 7:47115628-47115650 AGCCCCGTGGCAGGTGTGTGGGG - Intergenic
1024969417 7:55054742-55054764 AGCCATGTGAGTGGTGTGAACGG - Intronic
1025294112 7:57762019-57762041 AGCCCTGTGACAGGACTGCTGGG - Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1029946526 7:104539119-104539141 AGCCCTGTGAGGCCTGTGTCAGG + Intronic
1032900887 7:136305995-136306017 GGCCCTGTGAGAGGTTTGAGTGG + Intergenic
1033363971 7:140657418-140657440 AGCCCTTTCAGAAGTGTCTTCGG - Intronic
1033466191 7:141592213-141592235 AGCCCAGTGAGAGCTGCTTTGGG - Intronic
1035286242 7:157809244-157809266 AGCCCTGAGCGAGGTGTGGAAGG + Intronic
1035286277 7:157809377-157809399 AGCCCTGAGCGAGGTGTGGAAGG + Intronic
1037329799 8:17732973-17732995 ATCACTCTGAGAGTTGTGTTGGG - Intronic
1037632451 8:20670582-20670604 AGGTGTGTGAGAGGTGTGTGAGG + Intergenic
1039345319 8:36697376-36697398 TGCACTGTGAGAGGTATATTAGG + Intergenic
1040597877 8:48858018-48858040 AGCCCAGTGAGACCCGTGTTGGG + Intergenic
1042104849 8:65315509-65315531 AGCCCAGTGAGACCTATGTTGGG - Intergenic
1045245105 8:100435811-100435833 AGCCCAGTGAGACCTGTGTCAGG - Intergenic
1047721275 8:127642452-127642474 AGTCCTGTGCTATGTGTGTTGGG - Intergenic
1048273297 8:133046411-133046433 AGCACTGTGAGGGATGTGTGAGG - Intronic
1049610445 8:143552716-143552738 GGCCCTGTGGGAGGGGTGTCGGG - Intergenic
1052861481 9:33440523-33440545 AGCCATGTGAGAGGAGGGGTAGG + Intergenic
1053581320 9:39407376-39407398 AGCACTTTGAGAGGTGGGATCGG - Intergenic
1053845802 9:42235430-42235452 AGCACTTTGAGAGGTGGGATCGG - Intergenic
1054102907 9:60966175-60966197 AGCACTTTGAGAGGTGGGATCGG - Intergenic
1054583455 9:66940685-66940707 AGCACTTTGAGAGGTGGGATCGG + Intergenic
1054861814 9:69961651-69961673 AGCCCTGTGAAAGAAGTGTCAGG + Intergenic
1057009150 9:91586163-91586185 AGCACTTTGAGAGGTGAGGTGGG - Intronic
1057944028 9:99309077-99309099 AGCCTTGGGAGAGGGGTGCTGGG - Intergenic
1061047207 9:128172601-128172623 AGCCCTGTAAGAGCTCTGCTGGG + Intronic
1061213360 9:129206195-129206217 ACCCCTGTGGGAGGAGGGTTGGG + Intergenic
1061517623 9:131098611-131098633 AGCCCTTGGGGAGGTGGGTTGGG + Intronic
1061739939 9:132695074-132695096 AGCTCTGTGAGGGAAGTGTTAGG + Intergenic
1062543199 9:137050593-137050615 AGACCTGTGGGAGGTTTGTCAGG - Intronic
1185602528 X:1350128-1350150 AGAGCTGAGAGAGGTGGGTTTGG + Intronic
1186125142 X:6405403-6405425 AGCCCTGTGACAGGCATTTTGGG - Intergenic
1188373060 X:29392619-29392641 AGCTCTGTGAGATGAGTGTCTGG - Intronic
1190347351 X:49530648-49530670 AGCACTGTGGGAGGTGAGGTGGG - Intergenic
1190348450 X:49540204-49540226 AGCACTGTGGGAGGTGAGGTGGG - Intergenic
1190349551 X:49549760-49549782 AGCACTGTGGGAGGTGAGGTGGG - Intergenic
1190350655 X:49559313-49559335 AGCACTGTGGGAGGTGAGGTGGG - Intronic
1190351757 X:49568871-49568893 AGCACTGTGGGAGGTGAGGTGGG - Intergenic
1190352857 X:49578420-49578442 AGCACTGTGGGAGGTGAGGTGGG - Intergenic
1190353958 X:49587967-49587989 AGCACTGTGGGAGGTGAGGTGGG - Intergenic
1190355060 X:49597491-49597513 AGCACTGTGGGAGGTGAGGTGGG - Intronic
1190594290 X:52037588-52037610 AGTCCTGTGAGTGGTGCTTTTGG + Intergenic
1190595733 X:52051622-52051644 AGTCCTGTGAGTGGTGCTTTTGG + Exonic
1190613091 X:52202451-52202473 AGTCCTGTGAGTGGTGCTTTTGG - Exonic
1194614919 X:96088208-96088230 AGCCTTGACAGAGGTGTTTTGGG - Intergenic
1195381185 X:104272560-104272582 AGCCCTTTGAAAGGTTTGTCTGG + Intergenic
1195973244 X:110497026-110497048 AGCCTTCCTAGAGGTGTGTTTGG + Intergenic
1196501800 X:116392379-116392401 GGCCATGTGATAGGTGTCTTGGG + Intergenic
1197764035 X:130047882-130047904 AGCCCTGTGTTAGGTGTCATGGG - Intronic
1198333885 X:135648292-135648314 AGCCCAGTGAGTCTTGTGTTTGG + Intergenic