ID: 1139408391

View in Genome Browser
Species Human (GRCh38)
Location 16:66738330-66738352
Sequence TACTTAAACCCGGCAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73172
Summary {0: 1, 1: 8, 2: 548, 3: 12082, 4: 60533}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139408391_1139408399 16 Left 1139408391 16:66738330-66738352 CCTCCACCTGCCGGGTTTAAGTA 0: 1
1: 8
2: 548
3: 12082
4: 60533
Right 1139408399 16:66738369-66738391 TCCTGAGTAGCTGGGATTACAGG 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
1139408391_1139408395 7 Left 1139408391 16:66738330-66738352 CCTCCACCTGCCGGGTTTAAGTA 0: 1
1: 8
2: 548
3: 12082
4: 60533
Right 1139408395 16:66738360-66738382 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
1139408391_1139408397 8 Left 1139408391 16:66738330-66738352 CCTCCACCTGCCGGGTTTAAGTA 0: 1
1: 8
2: 548
3: 12082
4: 60533
Right 1139408397 16:66738361-66738383 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139408391 Original CRISPR TACTTAAACCCGGCAGGTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr