ID: 1139410302

View in Genome Browser
Species Human (GRCh38)
Location 16:66753260-66753282
Sequence GTGGATGACCTGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 569}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139410298_1139410302 21 Left 1139410298 16:66753216-66753238 CCATCAGTGACTTGGATAAGAAT 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG 0: 1
1: 0
2: 1
3: 45
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139410302 Original CRISPR GTGGATGACCTGAAGCAGGA AGG Intergenic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900948512 1:5844598-5844620 GTTGATGGGCTGAAGCAGAACGG - Intergenic
901172127 1:7266800-7266822 GTGGATGCCCTAAGGCTGGAAGG + Intronic
901343318 1:8515387-8515409 GTGGCTCACCTGAGGCAGGCAGG + Intronic
903151945 1:21415797-21415819 GTGGAAGACCTGATTCAGGTTGG - Intergenic
903879311 1:26498049-26498071 GAGGATCACTTGAACCAGGAAGG + Intergenic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
907546982 1:55270507-55270529 GTGGATCACTTGAACCTGGAGGG - Intergenic
908191420 1:61707163-61707185 GAGGATGGCTTGAACCAGGAAGG + Intronic
908385835 1:63640750-63640772 ATGGACGGCCTGAAGAAGGAAGG - Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
910913708 1:92265677-92265699 GAGGATCACCTGAAGCTGGGGGG + Intronic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911399530 1:97357973-97357995 GAGGATGAGCTGAAGCAGTGGGG + Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
912301482 1:108521034-108521056 GTGGGTGAGCTGAAGCAGAGTGG - Intergenic
912522896 1:110258623-110258645 GTGAATGATTTGAAGGAGGATGG - Intronic
913029392 1:114883780-114883802 GAGAATCACCTGAACCAGGAAGG - Intronic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915166369 1:153950020-153950042 GAGGATCACTTGAACCAGGAAGG - Intronic
915544162 1:156586455-156586477 CTGGATGACCTGAAAGAGGCAGG - Exonic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916379206 1:164189577-164189599 GGGGCTGAGCTGAAACAGGAGGG + Intergenic
916617760 1:166460306-166460328 GAGGATCACCTGAACCTGGAAGG - Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
918639206 1:186818306-186818328 GAGGCTGACTTGAATCAGGATGG + Intergenic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
919980189 1:202638052-202638074 GTGGCTGTACTGCAGCAGGAAGG - Intronic
920003008 1:202812136-202812158 GTTGACCACATGAAGCAGGAAGG + Intergenic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
922590962 1:226776217-226776239 GTAGGAGAGCTGAAGCAGGAAGG - Intergenic
923341259 1:233008911-233008933 GTGGATGCCCTGGAGCAGCTGGG + Intronic
923399565 1:233603145-233603167 GTGGAAGACATGAAGGTGGAAGG + Intergenic
923499319 1:234551249-234551271 TCGGATGACCAGAAGCTGGATGG - Intergenic
923571297 1:235117043-235117065 GAGGATGACATGAACCAGGGAGG + Intronic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
924441936 1:244093435-244093457 GTGGATGACCTGAGATGGGATGG + Intergenic
1064009797 10:11726687-11726709 GTGAAGGCCCTGAAGAAGGAAGG + Intergenic
1064129959 10:12700692-12700714 GTAGGAGAGCTGAAGCAGGAAGG + Intronic
1065508787 10:26456872-26456894 GTGGAAGACCTGTACTAGGATGG + Intronic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067201005 10:44172005-44172027 GTGTAGGGCCTGCAGCAGGAGGG + Intergenic
1067968496 10:50942045-50942067 TGGGAGGACCTGAAGAAGGAGGG - Intergenic
1068443877 10:57095442-57095464 AGGGATGACCTGAAGCCAGAGGG + Intergenic
1068470046 10:57448782-57448804 GAGGGTGACCTGAAGCATGGTGG - Intergenic
1068865153 10:61887324-61887346 GAGAATCACCTGAAGCTGGAAGG - Intergenic
1069264372 10:66438988-66439010 GAGGGTGACCCGAAGCAGGGTGG - Intronic
1070007134 10:72435562-72435584 GAGGACGAGCTGAAGCAGGGCGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072477649 10:95778117-95778139 GAGGACGAGCTGAAGCAGGGCGG - Intronic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072698428 10:97621652-97621674 GTGGATCACCTGAACCAGAATGG + Intronic
1072729006 10:97832195-97832217 GGGCATGAGCTGAAGCTGGAGGG + Intergenic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1072984998 10:100131451-100131473 GAGGATCACCTGAGGCATGATGG + Intergenic
1074105961 10:110389901-110389923 GTGGATGAGTTGAAGCCGGAGGG - Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075308650 10:121391790-121391812 TTGGATGAACTGAAGCAGACTGG + Intergenic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1077414320 11:2417771-2417793 GTGTATGACTTCGAGCAGGAGGG - Exonic
1078095063 11:8291737-8291759 GTGGAAGACCTCAGGCAGGCAGG + Intergenic
1078304929 11:10174426-10174448 GTGAATGAAATGAAGCAAGAAGG + Intronic
1078319880 11:10324850-10324872 GTGGGAAACCCGAAGCAGGAAGG + Intronic
1078457053 11:11483569-11483591 GTGGATGGCCAGGAGCAGGCTGG - Intronic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1079215852 11:18510830-18510852 GAGGATCACCTGAGCCAGGAAGG + Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1080424210 11:32141382-32141404 GAGGATCACCTGAGGCAGGGAGG - Intergenic
1080639150 11:34148745-34148767 GTGGAAGCACTGAAGCAGGCCGG - Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1084285719 11:68129093-68129115 GTGCATGCTCTGAAGGAGGAGGG - Intergenic
1085910723 11:80822280-80822302 GTTGGTGATCTGAAGGAGGACGG + Intergenic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1087131381 11:94672033-94672055 AGGGATGACCTGAAACATGAGGG + Intergenic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1088010107 11:104990392-104990414 GTTGATTACCAGAAGCTGGAAGG + Intergenic
1088012278 11:105017571-105017593 GTGAATGAAATGAAGCAAGAAGG + Intronic
1088381102 11:109193320-109193342 GAGGGTGAGTTGAAGCAGGATGG - Intergenic
1088455776 11:110031329-110031351 GTGAATCACCTGAAGGAGGGTGG - Intergenic
1089482516 11:118818133-118818155 GTGGATGACTTGAACCCGGGAGG + Intergenic
1089653955 11:119933669-119933691 GTGGAGGACCTGGAACAGCAGGG + Intergenic
1091806392 12:3359565-3359587 GTAAATGACGTAAAGCAGGAGGG + Intergenic
1092984337 12:13831092-13831114 GTGGGAGAGCGGAAGCAGGAAGG - Intronic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1094476621 12:30845532-30845554 GTGGATAAGCTGAAGCTGCATGG + Intergenic
1095201767 12:39393191-39393213 GTGCAAGACCTGCAGCAGTATGG + Intronic
1096561412 12:52438400-52438422 GTGGAAGATCTGAGGCAGGCTGG - Intergenic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097721612 12:63027961-63027983 GAAGATGACCTGAAGCAGCTTGG + Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099303524 12:80927249-80927271 GTGAATCGCCTGAAGCCGGAAGG - Intronic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1100428607 12:94510178-94510200 GTGCATGGCGTGAAGAAGGAGGG + Intergenic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1101671126 12:106874491-106874513 GTGAAGGACCTGCACCAGGATGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101926958 12:108980084-108980106 GAGGATGACTTGAGCCAGGAAGG + Intronic
1101950041 12:109167507-109167529 GAGGATCACTTGAAGCTGGAAGG + Intronic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1103818087 12:123674965-123674987 GAGGATCGCCTGAACCAGGAAGG - Intronic
1104076061 12:125391216-125391238 GCGGATGACCTGCAGCCTGAGGG - Intronic
1104910476 12:132237932-132237954 GTAGAGGCCCTGAAGCTGGAGGG - Intronic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1105388414 13:19954216-19954238 GAGGATGACGTGAACCCGGAAGG - Intergenic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1106855667 13:33849210-33849232 ATGCAAGACCTGAAGCAGGAAGG + Intronic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1113382610 13:109817569-109817591 GTGGATGCCATGAAACGGGATGG + Intergenic
1113424468 13:110196537-110196559 CTGGTTGAGCTGAAGCAGGCAGG - Intronic
1116165590 14:41330335-41330357 GAAGGTGAGCTGAAGCAGGACGG - Intergenic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118572828 14:67210908-67210930 GTGGATCACCTGAACCTGGGAGG + Intronic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1119694890 14:76705348-76705370 GCGGATGAGATGAAGCTGGAGGG - Intergenic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1121470676 14:94151835-94151857 GAGGGTGAGCTGAAGCAGGTTGG - Intronic
1121696187 14:95914201-95914223 GTGGATGATCTGAAGCTGGGAGG + Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122555319 14:102576037-102576059 GAGGATCACCTGAACCAGGGAGG - Intergenic
1125727623 15:41876109-41876131 GTGGAGGCCCTGCAGCAGGTGGG - Exonic
1125756961 15:42070915-42070937 ATGGATGACCTGTGGCAGGGTGG - Intronic
1125924178 15:43548640-43548662 GAGGATCACCTGAACCTGGAAGG - Intronic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1126720044 15:51568953-51568975 GAGGTTGAGCTGAAGCAGGGTGG + Intronic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1127566773 15:60196962-60196984 GTGGATCACTTGAGGCTGGAGGG + Intergenic
1127961850 15:63896009-63896031 GAGGCTGGCCTGGAGCAGGAGGG - Intergenic
1128020785 15:64388394-64388416 GTGAATCACCTGAACCCGGAAGG - Intronic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1130010969 15:80152812-80152834 GTGGAGGACCTGGAGCTGGCGGG + Exonic
1130053370 15:80502526-80502548 GTGGATGACATGAGTCTGGAAGG + Intronic
1130575571 15:85090187-85090209 GTTGTTCAGCTGAAGCAGGATGG - Intronic
1131133658 15:89916237-89916259 GTGGGTGACATGAAGGAGCAGGG + Intergenic
1131611596 15:93970160-93970182 GCTGATGACCTGAATCAGGGTGG + Intergenic
1131686304 15:94771779-94771801 GTGGATGACCACAAGCAATATGG - Intergenic
1131989884 15:98082867-98082889 GAGGATGACATGAGACAGGAGGG + Intergenic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1133117480 16:3585911-3585933 GAGGATCACCTGAGCCAGGAAGG + Intronic
1133237550 16:4394548-4394570 ATAGATGGCCTGAAGGAGGACGG - Intronic
1134027206 16:10963584-10963606 GTGGAGGGACTGAAGCAGGAGGG - Intronic
1134619979 16:15680627-15680649 GAGAATCACTTGAAGCAGGAAGG - Intronic
1135105495 16:19645765-19645787 CTGGGTGACCTGAGTCAGGAGGG + Intronic
1135176697 16:20236235-20236257 GTGGAGGACATGAAGGAGGTGGG - Intergenic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1136480046 16:30535438-30535460 CAGGAAGACGTGAAGCAGGAAGG + Intronic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1139309826 16:66018926-66018948 GAGGATCACTTGAACCAGGAAGG + Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139758396 16:69163973-69163995 GAGGATGACATGAACCCGGAAGG - Intronic
1139985690 16:70896730-70896752 AAGGATGACCTGGAGCATGAAGG - Intronic
1140816928 16:78629695-78629717 GTTGATTAGCTAAAGCAGGATGG - Intronic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1142801597 17:2349663-2349685 GCGGAGGAGCTGAAGCAAGATGG + Intronic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1145140115 17:20444231-20444253 GCGGATGACCTTCAGCAGGCTGG - Intergenic
1145398909 17:22515741-22515763 GGGGATGACCAGAGGCAGGGAGG + Intergenic
1147319489 17:39637214-39637236 GTGGCTGACATGGAGCAGGTGGG + Exonic
1148944606 17:51249168-51249190 GAGGATCACCTGAGGCAGGGAGG + Intronic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149192926 17:54085790-54085812 GAAGATGAGCTGAAGCAGGATGG + Intergenic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151073296 17:71242242-71242264 ATGGCTTTCCTGAAGCAGGATGG - Intergenic
1151927586 17:77210325-77210347 ACGAGTGACCTGAAGCAGGAGGG + Intronic
1152597942 17:81247009-81247031 TTTGATCACCTGAAGCAGGACGG + Exonic
1152709985 17:81866614-81866636 GTTAGTGACCTGAAGCATGAGGG + Intergenic
1203172031 17_GL000205v2_random:157354-157376 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1154471587 18:14708146-14708168 GAGGATCACCTGAGCCAGGAAGG - Intergenic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1156638837 18:39065214-39065236 GTGGACCATCTGAAGCAAGATGG - Intergenic
1157047617 18:44121735-44121757 GTGGAAGACATGAAGAAAGATGG + Intergenic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157370820 18:47109701-47109723 GGGTCTGACCTGAAGCATGAAGG - Intronic
1157493608 18:48139967-48139989 CTGGCTGACCTGAACCGGGAAGG - Intronic
1157668657 18:49510243-49510265 ATGGCAGACCTGGAGCAGGACGG + Intergenic
1158262883 18:55628237-55628259 CTGGATGACATTAAGAAGGAAGG + Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161195382 19:2983535-2983557 GTGAAGGCCCTGAGGCAGGACGG + Intronic
1161654510 19:5505896-5505918 GAGAATCACCTGAACCAGGAAGG - Intergenic
1161888829 19:7019135-7019157 GTGGATGAAGTGCAGGAGGAGGG - Intergenic
1161934619 19:7364016-7364038 GTGGATGAAAGGAAGGAGGATGG + Intronic
1162202359 19:9029839-9029861 GAGGATCACCTGAACCAGGGAGG + Intergenic
1162516418 19:11150691-11150713 GAGGATCACCTGAACCAGGGAGG + Intronic
1162862012 19:13513165-13513187 GAGGATCACCTGAACCTGGAAGG + Intronic
1163492549 19:17625281-17625303 GGGGATGAACCGAAACAGGAAGG + Intronic
1163517239 19:17772443-17772465 TTGGAAGCGCTGAAGCAGGAGGG - Exonic
1164085677 19:21899944-21899966 GTGGGTGAGCCGAAGCAGGGTGG - Intergenic
1164442271 19:28288214-28288236 GTGCCTGGGCTGAAGCAGGATGG - Intergenic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1166229659 19:41419052-41419074 GTGGGTGACCTGCAGCATGCTGG - Intronic
1166679590 19:44758710-44758732 GTCGATGACCTGTAGGAAGATGG - Exonic
1166756543 19:45195817-45195839 GTGGATCACCTGAAGTTGGGAGG - Intronic
1167050103 19:47072646-47072668 GTGGAGGAACTGAAGAAGCAGGG - Exonic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167947529 19:53001001-53001023 GAGGATCACCTGAACCAGAAAGG - Intergenic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
1168680891 19:58314999-58315021 GTGGATAACCTCAAGGAGCACGG - Exonic
925156190 2:1650313-1650335 GTGGATGACCTCCACCAGGCAGG - Intronic
926036503 2:9640050-9640072 GTGAATGACCCAAAGCAGCAGGG - Intergenic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
927594135 2:24382189-24382211 GAGGATGACTTGAACCCGGAAGG - Intergenic
927842538 2:26454797-26454819 GTGCATGTCATGGAGCAGGAGGG + Intronic
927904127 2:26845235-26845257 GAGGACGTGCTGAAGCAGGAAGG + Intergenic
928177966 2:29047851-29047873 GTGGATAAAATGTAGCAGGATGG + Intronic
929028682 2:37630009-37630031 TTGGAGGGCCTCAAGCAGGAGGG - Intergenic
929173216 2:38952450-38952472 CTGGATGACATGAAGTGGGATGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929581588 2:43084929-43084951 TTTGATGACTTGAAGAAGGAGGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
931030867 2:58173052-58173074 GTGAATGAAATGAAGCAAGAAGG + Intronic
931046822 2:58363149-58363171 GAGGATGAGCTGGAGCAGGGAGG - Intergenic
931180265 2:59892413-59892435 ATGGATGTTCTCAAGCAGGAAGG - Intergenic
931734574 2:65182236-65182258 GTGGATCACCTGAAGTCGGGAGG + Intergenic
932126466 2:69149478-69149500 GTAGATGAACTAAAGCAGAAGGG - Intronic
933430766 2:82175367-82175389 GAGAATGACTTGAAGCCGGATGG - Intergenic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934948505 2:98559769-98559791 GTGGTTGACCTGAGGTAGGGAGG + Intronic
935091487 2:99898932-99898954 GTGGAGGACAGGAAACAGGAAGG - Intronic
935237753 2:101152211-101152233 GTGGCTGGCCTGGAGCAGGCTGG + Intronic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936749575 2:115625105-115625127 GTGTCTGACCTAAAGCTGGAAGG + Intronic
936930133 2:117779568-117779590 ATGAATGAACTGAAGCAAGAAGG + Intergenic
937058930 2:118967208-118967230 GAAGGTGTCCTGAAGCAGGACGG + Intronic
937267180 2:120623863-120623885 GCGGAGGACCTGAAGTAAGATGG - Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
938022916 2:127920786-127920808 GAGGATGACCTGAACCCGGGCGG - Intergenic
938843766 2:135187336-135187358 GTGGATGACATCAGGCAAGATGG + Intronic
939470274 2:142612512-142612534 GTGAATGAAATGAAGCAAGAAGG - Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941404806 2:165074849-165074871 AGGGATGACCTGAAGCCTGAGGG + Intergenic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942434594 2:175957729-175957751 GACGATGAGCTGAAGCAGGGCGG + Intronic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
944015153 2:195026952-195026974 GTGGATGGATTGAGGCAGGAAGG + Intergenic
944495595 2:200305115-200305137 GAGGATTACCTGAACCAGGTAGG - Intergenic
945678298 2:212881967-212881989 GATGATGACTTGAATCAGGATGG + Intergenic
945920908 2:215753766-215753788 GTGGAGGACATGAAGGAGGCAGG + Intergenic
946178475 2:217936321-217936343 ATGGATGAACTGCAGCAGGCAGG - Intronic
946407994 2:219502330-219502352 GTGGCTGCCCTGGAGCAGGCGGG + Intronic
947567283 2:231202410-231202432 GAGGATCACTTGAACCAGGAAGG - Intronic
948233303 2:236367556-236367578 GTGTATGACCTGAATCACCAGGG - Intronic
948379099 2:237540761-237540783 GAGGCTGACCAGCAGCAGGAGGG - Intronic
948923844 2:241081576-241081598 CTTGATGACCTGATGCAGGGTGG - Intronic
1169325207 20:4670252-4670274 TGGGATGACCTTGAGCAGGAAGG - Intergenic
1169465217 20:5832028-5832050 GAGGATCACTTGAAGCAGGTAGG - Intronic
1170435965 20:16329103-16329125 TTGGATGACATGAGGCTGGAAGG - Intronic
1170683759 20:18550242-18550264 GAGGATCACCTGAACCTGGAAGG - Intronic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1172445242 20:34989961-34989983 GTGGGAGACCTGGAGCAGGGCGG - Intronic
1174139909 20:48405629-48405651 GTGTATGAGCTCAAGGAGGAAGG - Intergenic
1174177145 20:48652348-48652370 GTGGATCACTTGAACCAGGGAGG + Intronic
1176328014 21:5519191-5519213 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176399743 21:6301760-6301782 TTGGGTGACCGAAAGCAGGAAGG + Intergenic
1176437414 21:6687344-6687366 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176461676 21:7014414-7014436 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176485237 21:7396192-7396214 TTGGGTGACCGAAAGCAGGAAGG - Intergenic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1176802899 21:13449770-13449792 GAGGATCACCTGAGCCAGGAAGG + Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177092064 21:16781678-16781700 GAAGGTGAGCTGAAGCAGGATGG + Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1177513764 21:22121993-22122015 GGGGAGGACCTGAAGGAGCAGGG - Intergenic
1178485110 21:33014213-33014235 GTGAATGCCCTGAAGCAGTGGGG - Intergenic
1178549982 21:33528864-33528886 GTGGATGGCATGCAGCAAGAGGG - Exonic
1178615423 21:34128916-34128938 GTGCATGACCTGGAGCTGGGTGG + Intronic
1179424110 21:41259919-41259941 GAGGATCACCTGAACCAGGGAGG - Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1182058970 22:27383046-27383068 GTCCATCACCTGAACCAGGATGG + Intergenic
1182184845 22:28391568-28391590 GTGAATGAAATGAAGCAAGAAGG - Intronic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1183583294 22:38738237-38738259 GACGAAGACCTGCAGCAGGAGGG - Exonic
1183752624 22:39730459-39730481 GCAGATGAGCTGAAGCAGGAGGG - Intergenic
1184718885 22:46297458-46297480 ATGGATGACCCTAAGAAGGAAGG + Exonic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
950052362 3:10002376-10002398 GAGGATCACCTGAACCTGGAAGG - Intronic
951019723 3:17769214-17769236 GAGAATGACCGGAGGCAGGAGGG - Intronic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951705977 3:25545049-25545071 GCGGATCACCTGAACCTGGACGG - Intronic
951888452 3:27547203-27547225 GAGGATCACCTGAGCCAGGAAGG + Intergenic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
953331896 3:42060715-42060737 GAGAATGACTTGAACCAGGAAGG - Intronic
953333209 3:42071808-42071830 TTAGATGTCCCGAAGCAGGATGG - Intronic
953751631 3:45612968-45612990 CTGCATGACCTGAAACAAGAAGG - Intronic
954827905 3:53391297-53391319 GAGGATGAGCTGAAACAGGGTGG + Intergenic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
959412640 3:106044571-106044593 GTGTATGAGCTGAAGCTGCAAGG + Intergenic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
960167870 3:114424462-114424484 GTGCATTACATGAAGCTGGAAGG - Intronic
960183536 3:114611184-114611206 TTGGTTGAACTGAAGAAGGAAGG + Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962278373 3:134032071-134032093 GTGGAAGACAGGAAACAGGAAGG + Intronic
962512258 3:136114111-136114133 GAGGGTGACCCGAAGCAGGGTGG + Intronic
963887582 3:150599265-150599287 GAGGATCACCTGAGCCAGGAAGG - Intronic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
964816941 3:160727731-160727753 AGAAATGACCTGAAGCAGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966351758 3:179038732-179038754 GAGGACGAACTGAAGCAGGGTGG + Intronic
966999089 3:185314725-185314747 GAGGATCACTTGAGGCAGGAGGG - Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967665968 3:192172297-192172319 GAGGATGACTTGAACCAGGGAGG + Intronic
968644841 4:1735293-1735315 GTGGATTACCTGGAGCAGTTTGG + Exonic
970045283 4:11845613-11845635 GAGGATCACCTGAATCTGGAAGG + Intergenic
970802529 4:19990989-19991011 GACGATGACCTGAACCAGGATGG - Intergenic
972724345 4:41733108-41733130 GTGTATGACCAGATGCAGTAGGG + Intergenic
972755477 4:42041904-42041926 GAGGGTGACCCGAAGCAGGGTGG + Intronic
973609595 4:52622836-52622858 GCAAAGGACCTGAAGCAGGAAGG + Intronic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976580557 4:86730776-86730798 GAGGATGAGCTGAAGCCGGACGG - Intronic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
976905289 4:90228886-90228908 GTGAATGAAATGAAGCAAGAAGG + Intronic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977671320 4:99698894-99698916 GAGGACGACCAGAAGCAGGGTGG + Intergenic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979196274 4:117923265-117923287 GTGAATGAAATGAAGCAAGAAGG + Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
980912517 4:139006480-139006502 GTGAATCACCTGAACCAGGGAGG + Intergenic
980917058 4:139043391-139043413 GTGGATGTGCAGAAGCAGAAAGG - Intronic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982004278 4:151049408-151049430 GAGGATGGCCTGCCGCAGGATGG + Intergenic
982505608 4:156213602-156213624 CAGGAAGACTTGAAGCAGGAGGG + Intergenic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984408567 4:179366365-179366387 GTGGATCACCTGAAGCCAGGAGG + Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
986216756 5:5726655-5726677 GTGGAGGATCTGAAGGAGAAAGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987041404 5:14066464-14066486 GTGGAGCACCTAAAGCTGGAAGG - Intergenic
987171980 5:15268832-15268854 ATGTTTGACCAGAAGCAGGAGGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987781529 5:22442688-22442710 GAGGATGATCTGAAGTAGGCAGG + Intronic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
993366755 5:87042993-87043015 GAGGGTGAGCTGAAGCAGGTCGG - Intergenic
993396765 5:87398881-87398903 GAGAATGACCTGAACCTGGAAGG + Intronic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993891612 5:93482296-93482318 GAGGATGAGCCGAAGCAGGTGGG + Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
996913815 5:128686923-128686945 GTAGATGATATGAAACAGGAGGG + Intronic
997220442 5:132157658-132157680 GAGGGCGACCTGAAGCAGGGTGG - Intergenic
997380830 5:133436369-133436391 GAGGATGACCTGTGGCAGGAAGG + Intronic
997435373 5:133870299-133870321 GTGGAAGACCTGAGTCAGGGTGG + Intergenic
998261019 5:140632001-140632023 GTGGATAACCTGACACTGGACGG - Exonic
999150234 5:149421743-149421765 GAGGATGACAAGAAGCAGAATGG + Intergenic
999371259 5:151056681-151056703 GTGGATTCCCAGGAGCAGGAAGG + Intronic
999634700 5:153609651-153609673 GAGAATGACCTGAACCCGGAAGG - Intronic
999686939 5:154111570-154111592 GAGGATTACCTGAGGCTGGAAGG + Intronic
999755154 5:154658739-154658761 ATGGGTGACCTGGAGAAGGAGGG - Intergenic
1000121177 5:158199110-158199132 GTGGATGACCTTGGGCAAGAAGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1002662179 5:180798795-180798817 GTGGAAGATCAGAAGCAGCATGG - Intronic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004169966 6:13288240-13288262 CTGGATCAACTGGAGCAGGAAGG - Exonic
1004475736 6:15969542-15969564 TTGGATCACCTGAAGCTGGCTGG - Intergenic
1004621831 6:17337395-17337417 GAGGATCACCTGAACCAGGGAGG + Intergenic
1004772334 6:18797839-18797861 GCAGATGAGCTGAAACAGGAAGG + Intergenic
1005101750 6:22179584-22179606 ATGAATGAACTGAAGCAAGAAGG - Intergenic
1005414793 6:25588446-25588468 GAGGATGACATAAAGCATGAAGG + Intronic
1005446680 6:25931200-25931222 ATGGATGATATGAAACAGGAAGG - Intergenic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1006449624 6:34098636-34098658 GTGGAGGGCCTGAAGCAGCCAGG - Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007369681 6:41418105-41418127 GGGGATGTCCTGAACCAGAATGG - Intergenic
1007506283 6:42337702-42337724 GGGGAGGAGCTTAAGCAGGAGGG + Intronic
1007943858 6:45807708-45807730 TCTGGTGACCTGAAGCAGGATGG + Intergenic
1009239219 6:61163570-61163592 GTGCATGAGCCGAAGCAGGGTGG - Intergenic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1011558101 6:88589633-88589655 GTGGATGACACGGATCAGGATGG - Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012249823 6:96967850-96967872 GGGCATGCCCTGAGGCAGGAAGG + Intronic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1015596534 6:134872397-134872419 GGGAAAGACCTGAAGGAGGAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1016428890 6:143962720-143962742 GTGAATGAGCTGAAACTGGAAGG - Intronic
1017067573 6:150543451-150543473 TTGGATGACCTGAAGAAGTGTGG - Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018583917 6:165334966-165334988 GTGGATGCCCTGTGGGAGGACGG - Intronic
1018890031 6:167976703-167976725 GAGCAGGACCTGAACCAGGAAGG - Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1021628748 7:22622909-22622931 GTGGATGAGGTGAAGCAAGCAGG - Intronic
1021701379 7:23322336-23322358 GTGAATGAAATGAAGCAAGAAGG + Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1023410040 7:39881178-39881200 TGAGAAGACCTGAAGCAGGAGGG - Intergenic
1024308556 7:47948263-47948285 GTGGAGGCCCTGTACCAGGAGGG - Intronic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024495361 7:50040510-50040532 GTGGGCGAGCTGAAGCAGGGTGG + Intronic
1024686395 7:51750673-51750695 GTGCAAGGCCGGAAGCAGGAAGG - Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025091297 7:56066282-56066304 GTGCATCAGCTGAAGCAGTATGG + Intronic
1025849052 7:65230712-65230734 GTGGATCACCTGAACCAGGTTGG - Intergenic
1025956210 7:66185189-66185211 GAGGATCACCTGAATCTGGAAGG - Intergenic
1026151128 7:67788901-67788923 GTGGGTGCTCCGAAGCAGGACGG - Intergenic
1026285826 7:68962043-68962065 GACGATCACCTGAACCAGGAAGG + Intergenic
1026614240 7:71887521-71887543 GTGGATCACCTGAAGTGGGGGGG - Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028136763 7:87230606-87230628 AAGGATGGCCTGAAGCATGAGGG + Intergenic
1028533481 7:91864464-91864486 GAGGATCACCTGAGACAGGAAGG + Intronic
1029591184 7:101508071-101508093 GTGGAAGACATGAGGCTGGAGGG - Intronic
1030065488 7:105655869-105655891 GTGCATGCCCTGCAGCAGGTGGG - Intronic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1030612720 7:111706489-111706511 GAGGGTGAGCTGAAGCAGGTTGG - Intergenic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1032813237 7:135444048-135444070 GAGGATCACCTGAGCCAGGAGGG + Intronic
1033238671 7:139658964-139658986 ATGGATGTCTTAAAGCAGGAGGG + Intronic
1034278091 7:149832871-149832893 GTGGATGACCGGCAGCACCACGG - Intergenic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1034943203 7:155245222-155245244 GAGGATGAGCTGATGCAGGCAGG - Intergenic
1035867950 8:3104928-3104950 GTGGATCACCTGAGGCTGGGAGG - Intronic
1036242984 8:7094525-7094547 TCGCATGACCTGAAGCATGATGG + Intergenic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1038693114 8:29781209-29781231 GAGGAAGCCCTGAACCAGGATGG + Intergenic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1040412532 8:47168914-47168936 GAGGATGACCTGAGCCAGGGAGG + Intergenic
1040563489 8:48545411-48545433 GGGGCTGACAGGAAGCAGGATGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1042100915 8:65274134-65274156 GTTGTTGACCTGAAGCCGCATGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1043478167 8:80625642-80625664 GAGGATCACCTGAGCCAGGAAGG - Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044060184 8:87626090-87626112 ATGAATGACATGAAGCAAGAAGG + Intergenic
1044918079 8:97137376-97137398 GTGGATGTCAGGAAACAGGAAGG - Intronic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045528604 8:102962911-102962933 GTGGATCACCTGAGCCAGGGAGG - Intronic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045800233 8:106093525-106093547 CTGGATGCCATGAAGCAGAATGG + Intergenic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1046366985 8:113246981-113247003 GTGGAGGACCAGAAGTAGTAAGG + Intronic
1046666426 8:117008734-117008756 AAGCATGACCTGAAGCAGAAGGG - Intronic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1048072693 8:131039416-131039438 GAGGATGACCTGCAGCAGCGAGG + Exonic
1049425694 8:142537011-142537033 GTGGTTGACCGGCAGGAGGAGGG + Exonic
1049466411 8:142752964-142752986 ACAGATGACCTGAGGCAGGAGGG - Intergenic
1049589629 8:143451210-143451232 GGGGAAAACCTAAAGCAGGAGGG + Intronic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1050884528 9:10747202-10747224 GTGAATGACCTGAATAAGCAAGG + Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052419165 9:28219963-28219985 CTGGATGACATGAACTAGGATGG + Intronic
1053208600 9:36208709-36208731 GTGCATTAACTGAAACAGGAAGG + Intronic
1053290533 9:36876825-36876847 GGGGATGCCCTGGAGCCGGAAGG + Intronic
1055000123 9:71439503-71439525 GCGAATGACCTGAACCAGGCTGG + Intronic
1056003608 9:82243297-82243319 GAAGGTGAGCTGAAGCAGGATGG - Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1058123996 9:101170848-101170870 GAGGATGACTTGAACCAGGAAGG + Intronic
1060279010 9:122203578-122203600 GTGGAAGAGTTGTAGCAGGATGG + Exonic
1061223644 9:129267338-129267360 GTCGATGTCTGGAAGCAGGAAGG + Intergenic
1062391375 9:136335293-136335315 GTGGATGACGCCAGGCAGGAAGG - Intronic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1186908480 X:14136400-14136422 GGGGATGACCTCATGAAGGACGG + Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1187710607 X:22049772-22049794 GTGAATCACTTGAACCAGGAGGG + Intronic
1187944464 X:24412693-24412715 GTGGATGACAGGAGGCAGGAGGG - Intergenic
1188076819 X:25787322-25787344 GTGACTGACCTGAAGCTGGGGGG + Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188790368 X:34402162-34402184 GTGGACTACTAGAAGCAGGAGGG + Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1190209519 X:48433610-48433632 GAGTATGACCCGAAGCAGGGCGG + Intergenic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191705040 X:64085545-64085567 GAGGGTGAGTTGAAGCAGGATGG + Intergenic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1192129063 X:68530761-68530783 GGGGGTGAGCTGAAGCAGGGTGG - Intronic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193406413 X:81107295-81107317 ATGGCTGACCTGAAGCAGCTGGG - Intergenic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194915977 X:99709146-99709168 GTTGATGGCTTGAAGAAGGAAGG - Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196665246 X:118309282-118309304 GAGGATGACCTGAGCCTGGAGGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1200770597 Y:7121484-7121506 GTGGAGGAACTAGAGCAGGATGG - Intergenic
1200900149 Y:8423228-8423250 GTGGATCACTTTAAGCAGCATGG - Intergenic
1201476330 Y:14385925-14385947 TTGAATAACCTGAAGCAGAAAGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1202250832 Y:22871070-22871092 GTGGATCACTTCAAGCAGCATGG - Intergenic
1202403821 Y:24504819-24504841 GTGGATCACTTCAAGCAGCATGG - Intergenic
1202466958 Y:25165263-25165285 GTGGATCACTTCAAGCAGCATGG + Intergenic