ID: 1139415098

View in Genome Browser
Species Human (GRCh38)
Location 16:66801604-66801626
Sequence CCCACGGACGTGAGCCTGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139415098_1139415108 15 Left 1139415098 16:66801604-66801626 CCGACCAGGCTCACGTCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1139415108 16:66801642-66801664 GCAGCCCCGCCGCCCCTGCAAGG 0: 1
1: 1
2: 3
3: 34
4: 362
1139415098_1139415105 -7 Left 1139415098 16:66801604-66801626 CCGACCAGGCTCACGTCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1139415105 16:66801620-66801642 CCGTGGGCGGGACTTCCGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139415098 Original CRISPR CCCACGGACGTGAGCCTGGT CGG (reversed) Exonic
900592191 1:3465106-3465128 CCCATGGGCCTGGGCCTGGTGGG - Intronic
903261914 1:22136150-22136172 CCCTTGGACCTGAGCCTGGATGG + Intronic
904825615 1:33272018-33272040 CCCAGGGAACTGAGGCTGGTGGG + Intronic
905802860 1:40856581-40856603 GCCAAGGACCTGAGCCTGGGTGG - Intergenic
1065867251 10:29925076-29925098 CACATTGACGTGAGGCTGGTTGG - Intergenic
1072717054 10:97759317-97759339 CCCAAGGACGGGTGCCTGGTTGG - Exonic
1078549920 11:12272936-12272958 CCCATGGACGTGAGGCTTGGCGG - Intergenic
1080298776 11:30760333-30760355 CCCACCAACGTGATACTGGTGGG + Intergenic
1084174485 11:67416225-67416247 CCCAGGGACTTGGGCCTTGTGGG - Intronic
1085402499 11:76243195-76243217 CCCAGGAAAGTGGGCCTGGTGGG + Intergenic
1091974745 12:4815322-4815344 TCCACAGAGGTGAGCATGGTAGG - Intronic
1097250347 12:57629034-57629056 CCCAGGGAGGTGAGGCTGGTAGG - Exonic
1110228110 13:73140983-73141005 CCCAGGGACGAGAGTCTGGAGGG + Intergenic
1116057776 14:39885388-39885410 CCCACGGTGGTGAGGCTTGTGGG - Intergenic
1122172595 14:99889299-99889321 CCCAAGGATCTGTGCCTGGTGGG - Intronic
1124566694 15:30822138-30822160 CGCAGGGAAGTGAGCCTGATGGG + Intergenic
1139415098 16:66801604-66801626 CCCACGGACGTGAGCCTGGTCGG - Exonic
1146455929 17:33009648-33009670 CCCACAGGTGTGATCCTGGTGGG - Intergenic
1148746225 17:49919928-49919950 GCCAAGCAGGTGAGCCTGGTGGG - Intergenic
1151729986 17:75905224-75905246 CCCAGGGACGCAGGCCTGGTTGG + Exonic
1152373950 17:79908315-79908337 CCCACGGGCGTGGGTCTGCTGGG + Intergenic
1157219854 18:45820629-45820651 TCCACGGACCTGAGCCAGCTGGG + Intergenic
1157863169 18:51159804-51159826 CCCTCGGCAGTGAGGCTGGTAGG - Intergenic
1159944400 18:74433181-74433203 CCCATGAATGTGAGCCGGGTGGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1165992795 19:39825896-39825918 CTGATGGATGTGAGCCTGGTGGG - Exonic
1166295596 19:41887858-41887880 CCCAGGGACGGGAGCCTTGCGGG - Intronic
1166717773 19:44979731-44979753 CACATGGACGTCAGCCGGGTGGG - Intronic
925252952 2:2456879-2456901 GTCACTGACGTGAGCCTGTTGGG - Intergenic
927844086 2:26462362-26462384 CCCACAGCCATGTGCCTGGTGGG - Intronic
930091617 2:47535141-47535163 CCCACAGAAGCCAGCCTGGTTGG + Intronic
1169210858 20:3765660-3765682 CCCAGGGACGTCAGCCTTCTTGG + Intronic
1169251319 20:4063498-4063520 CCCAGGGACGGGGGGCTGGTTGG + Intergenic
1183939528 22:41285579-41285601 CCCGCGGGCGTGGGCCTGCTGGG + Intronic
1184152068 22:42645063-42645085 CCCATGGAAGTGAGCCTGGGTGG + Intronic
954370619 3:50168091-50168113 CCCAGGTAGGTGAGCCAGGTTGG - Intronic
968400326 4:289841-289863 CTCATGGAGGTGGGCCTGGTGGG - Intronic
968960270 4:3739827-3739849 CCCACGCACCTCAGCCCGGTGGG - Intergenic
971763631 4:30801982-30802004 CCCACGGAATTTAGCCTGGTAGG - Intronic
987005123 5:13702930-13702952 CCTACAGACGTGAGGTTGGTGGG - Intronic
1001134477 5:169091030-169091052 CTCAAGGAGGTCAGCCTGGTAGG - Intronic
1022185217 7:27960746-27960768 CTCACGGACCTGAGCCTGCTGGG - Intronic
1028776714 7:94685450-94685472 CCCACTGACCTGCCCCTGGTGGG + Intergenic
1030348069 7:108455733-108455755 CGCACGGGCGTGTGCCTGTTCGG - Intronic
1032201491 7:129825729-129825751 CTCATCGACGTGACCCTGGTAGG - Intergenic
1037806257 8:22059308-22059330 CCCACCGACGCCAGCCTGCTTGG + Exonic
1039568500 8:38567583-38567605 CTCAAGGAGGTGAGGCTGGTCGG - Intergenic
1039663595 8:39495379-39495401 CCCATGGTGGTGAGGCTGGTAGG - Intergenic
1057040085 9:91841747-91841769 CCCTCGGATGCCAGCCTGGTGGG + Intronic
1057772217 9:97978788-97978810 CCCACAGAGGGGTGCCTGGTTGG + Intergenic
1062623081 9:137431328-137431350 CCCACGCACCTGCTCCTGGTAGG - Exonic
1189184668 X:39043585-39043607 CCCACAGACTTGAGGCTGATAGG - Intergenic
1189869178 X:45364564-45364586 CCCACGGAAATGAGCCAAGTCGG + Intergenic