ID: 1139417327

View in Genome Browser
Species Human (GRCh38)
Location 16:66824030-66824052
Sequence TAGGAGAAGCAGAATTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 623}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139417327 Original CRISPR TAGGAGAAGCAGAATTGGCT GGG (reversed) Intronic
901241740 1:7698214-7698236 CAGAAGAAGAAGAATTGTCTTGG + Intronic
901304939 1:8226073-8226095 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901574641 1:10191132-10191154 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
901600110 1:10416984-10417006 TAGGAGAAGCTGTCTTTGCTCGG + Exonic
902163083 1:14547976-14547998 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
902866005 1:19279983-19280005 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
903402806 1:23069437-23069459 TGGAAGAAGAAGAATTGTCTTGG + Intronic
903983757 1:27209508-27209530 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
905403587 1:37719214-37719236 CAGGAGAAGCAGAAGTGACCAGG + Intronic
905744188 1:40399894-40399916 TAGCTGAAACAAAATTGGCTAGG + Intronic
906075361 1:43048194-43048216 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
908078470 1:60547192-60547214 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
908146899 1:61256046-61256068 TGGAAGAAGAAGAATTGCCTTGG + Intronic
908249773 1:62256117-62256139 TGGAAGAAGAAGAATTGTCTTGG - Intronic
909012865 1:70354273-70354295 TACCAGAAGCAGGATTGGCAAGG - Exonic
909347821 1:74612950-74612972 TGGAAGAAGAAGAATTGTCTTGG + Intronic
909459474 1:75893572-75893594 GAGGAGACTCAGCATTGGCTGGG - Intronic
909762635 1:79311506-79311528 TATGAGAAACAGAATTCTCTAGG + Intergenic
910109275 1:83665154-83665176 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
910275834 1:85448191-85448213 TGGAAGAAGAAGAATTGTCTTGG - Intronic
910660062 1:89662090-89662112 TTGAAGAAGAAGAATTGTCTTGG + Intronic
910730583 1:90391664-90391686 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
911236188 1:95415066-95415088 TGGGAGAAGAAGAATTATCTTGG - Intergenic
911280416 1:95920513-95920535 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
911524633 1:98969490-98969512 TATGCGCAGCAGAAGTGGCTAGG + Intronic
911651769 1:100397091-100397113 TGGAAGAAGAAGAATTGTCTTGG - Intronic
911749533 1:101480732-101480754 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
911933778 1:103939797-103939819 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
912809585 1:112783860-112783882 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
913040938 1:115022562-115022584 TGGGAGAAGCTGAATAGTCTGGG + Intergenic
913355869 1:117921579-117921601 TAGGAAAAGCAGAATAAGCTAGG + Intronic
913359776 1:117967407-117967429 TAGAAGAAGAAGTATTGTCTTGG + Intronic
913578344 1:120199822-120199844 TTTAAGAAGCAGACTTGGCTGGG - Intergenic
913629828 1:120698529-120698551 TTTAAGAAGCAGACTTGGCTGGG + Intergenic
913647974 1:120879508-120879530 TAGGAGAAGGTTAATTGGCATGG - Intergenic
913691725 1:121285930-121285952 TGGAAGAAGAAGAATTGTCTTGG + Intronic
914078653 1:144383329-144383351 TAGGAGAAGGTTAATTGGCATGG + Intergenic
914100526 1:144583173-144583195 TAGGAGAAGGTTAATTGGCATGG - Intergenic
914145820 1:144994025-144994047 TGGAAGAAGAAGAATTGTCTTGG - Intronic
914173560 1:145251877-145251899 TAGGAGAAGGTTAATTGGCATGG + Intergenic
914298458 1:146354480-146354502 TAGGAGAAGGTTAATTGGCATGG + Intergenic
914528214 1:148493018-148493040 TAGGAGAAGGTTAATTGGCATGG + Intergenic
914638172 1:149574049-149574071 TAGGAGAAGGTTAATTGGCATGG - Intergenic
914801835 1:150967882-150967904 CAGAGGAAGCAGAAATGGCTAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915810295 1:158902040-158902062 TAGAAGATGGAGAAATGGCTAGG + Intergenic
915882428 1:159685928-159685950 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
915933193 1:160073010-160073032 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
916095488 1:161346098-161346120 TAAAAGACGCAGATTTGGCTGGG - Intronic
916531593 1:165661463-165661485 TGGAAGAAGAAGAATTGTCTTGG + Intronic
916609237 1:166374059-166374081 TAAGAAAAGCAGAATAGGCTGGG - Intergenic
916763230 1:167835591-167835613 TATTAAAACCAGAATTGGCTGGG + Intronic
917494020 1:175523958-175523980 TAGGAGGAGCAGCATGGGCAAGG - Intronic
917506442 1:175631540-175631562 TGGAAGAAGAAGAATTGTCTTGG - Intronic
917751179 1:178055016-178055038 TAGGAGCAGAAGAATGGGCGTGG + Intergenic
917919543 1:179739596-179739618 TGGAAGAAGAAGAATTGCCTTGG - Intergenic
918192460 1:182188791-182188813 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
918385066 1:183997504-183997526 TGGAAGAAGAAGAATTGTCTTGG + Intronic
918450344 1:184651441-184651463 TGGAAGAAGAAGAATTGTCTCGG - Intergenic
918478583 1:184952501-184952523 TGGAAGAAGAAGAATTGTCTTGG + Intronic
918527161 1:185477745-185477767 CAGTAGAAGAAGAATTGTCTTGG - Intergenic
918527961 1:185485750-185485772 TGGGAGAATAAGAATTGTCTTGG + Intergenic
918656734 1:187036081-187036103 AAGGAGAGGCAGAATTAGTTTGG - Intergenic
919491997 1:198215535-198215557 CAGAAGAAGAAGAATTGTCTTGG - Intronic
920112855 1:203599302-203599324 TAGGGGAAGGAGAAAGGGCTGGG - Intergenic
920175197 1:204096830-204096852 GAGGAGGAGGAGAATTGGCAAGG - Intronic
920268606 1:204745669-204745691 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
920332712 1:205222320-205222342 TTGAAGAAGAAGAATTGTCTTGG + Intergenic
920479056 1:206304439-206304461 TGGAAGAAGAAGAATTGTCTTGG + Intronic
920870245 1:209788172-209788194 TAGTAGAAGGAGATTTGGCCTGG - Exonic
921409300 1:214817850-214817872 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
921660178 1:217792008-217792030 AAGAAGAAGAAGAATTGTCTTGG + Intronic
921688637 1:218121297-218121319 TGGAAGAAGGAGAATTGTCTTGG - Intergenic
921808683 1:219486635-219486657 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
922237097 1:223730397-223730419 TGGAAGAAGAAGAATTGTCTTGG - Intronic
922874045 1:228925997-228926019 TAGGAGAATCAGATTTTGATGGG - Intergenic
923219818 1:231882934-231882956 TAGGAGAAGAAGGAATGGGTGGG + Intronic
923329668 1:232911053-232911075 TGGAAGAAGTAGAATTGTCTTGG - Intergenic
923717132 1:236434601-236434623 TGGAAGAAGAAGAATTGTCTTGG - Intronic
923828091 1:237522230-237522252 TAGCAGAAAAAGAATTGTCTTGG + Intronic
923905930 1:238383672-238383694 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
923954668 1:239002371-239002393 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
923978710 1:239295644-239295666 TAGGAAAAGAAGAATTGTTTTGG + Intergenic
924146027 1:241075535-241075557 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1063023842 10:2157875-2157897 TAGGATAATCAGAATGGGTTTGG + Intergenic
1063536307 10:6887093-6887115 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1063599018 10:7463239-7463261 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1063821521 10:9841973-9841995 TGGGAGAAGCAGAATTGCGGTGG - Intergenic
1064140889 10:12789274-12789296 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1064512479 10:16110634-16110656 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1064983429 10:21186720-21186742 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1065248369 10:23783126-23783148 TGGAAGAAGGAGAATTGCCTTGG + Intronic
1065559608 10:26949197-26949219 TAGGTGAAGCAAAATTGGCAAGG - Intergenic
1065607240 10:27430413-27430435 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1065616771 10:27535312-27535334 TAGAAGAAGAAGAATAGTCTTGG - Intronic
1065700165 10:28417198-28417220 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
1065718706 10:28603177-28603199 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1065750424 10:28881098-28881120 CAGAAGAAGAAGAATTGTCTTGG - Exonic
1066176087 10:32907761-32907783 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1067380370 10:45767679-45767701 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1067463618 10:46477216-46477238 TAGGAGAAAAATCATTGGCTAGG + Intergenic
1067623577 10:47907435-47907457 TAGGAGAAAAATCATTGGCTAGG - Intergenic
1067881140 10:50046297-50046319 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1067888073 10:50108334-50108356 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1068025038 10:51632163-51632185 TAGAAGAAGAAGAACTGTCTTGG - Intronic
1068091846 10:52441498-52441520 TTGGAGATCCAGAATTGGTTAGG + Intergenic
1068458075 10:57286022-57286044 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
1069105701 10:64380914-64380936 TCAAAGAAACAGAATTGGCTGGG - Intergenic
1069169656 10:65210343-65210365 TGGAAGAAGTAGAATTGTCTTGG + Intergenic
1069879784 10:71584766-71584788 CAGGAAAAGCAGAATTGCTTTGG + Intronic
1070050927 10:72888947-72888969 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1070161803 10:73871395-73871417 TAAGAGAAGGAGAGATGGCTGGG - Intronic
1070298063 10:75181859-75181881 TGGGGGAAGCAAAATTAGCTGGG + Exonic
1071435064 10:85641285-85641307 TTGGAGATGCAGAATTGGCCTGG - Intronic
1071623712 10:87146657-87146679 TGGAAGAAGGAGAATTGTCTTGG - Intronic
1071824444 10:89310773-89310795 GAGGAGAAGCAGAACTGTTTGGG - Intronic
1071837799 10:89436716-89436738 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1072844188 10:98810692-98810714 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1074744154 10:116514908-116514930 AAGGAGAGGAAGTATTGGCTGGG + Intergenic
1075435639 10:122438803-122438825 TGGAAGAAGAAGAATTGTCTTGG + Exonic
1075491497 10:122874877-122874899 TGGGAAAAGAAGAATTGTCTTGG - Intronic
1075952630 10:126495073-126495095 TAGCAGAAGCACCATGGGCTTGG - Intronic
1076063942 10:127433896-127433918 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1076210773 10:128642887-128642909 TGGAAGAAGAAGAATTGCCTTGG + Intergenic
1077381610 11:2244325-2244347 TGGGAAAAGAAGAATTGTCTTGG - Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1081270788 11:41079837-41079859 TGGAAGAAGAAGAATTGCCTTGG - Intronic
1082138547 11:48579219-48579241 GAGGAGAAGTAGAATTGTCAAGG + Intergenic
1082771589 11:57211684-57211706 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1084300448 11:68247230-68247252 TGGAAGAAGAAGAATTGACTTGG + Intergenic
1084397777 11:68925018-68925040 TAAAAGAAGAAGAATTGTCTTGG - Intronic
1085178769 11:74514166-74514188 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1086182713 11:83973613-83973635 TGGTAGCAGCAGAATGGGCTAGG + Intronic
1086215486 11:84374538-84374560 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1086226991 11:84524042-84524064 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1086227954 11:84535291-84535313 TAGGAGAAGGAGTATTGATTTGG + Intronic
1087266700 11:96069376-96069398 TAAGATAAACAAAATTGGCTGGG + Intronic
1090129154 11:124121539-124121561 TATAAGAAGAAGAATTGTCTTGG - Intronic
1090589786 11:128253062-128253084 CTGGAGAAGAAGAATTGTCTTGG + Intergenic
1090869517 11:130730935-130730957 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1091270745 11:134310153-134310175 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1091315589 11:134611745-134611767 TAGGGGAAGCATCATTTGCTGGG + Intergenic
1091828569 12:3533502-3533524 TAGAAGAAGAAGAATGGTCTTGG - Intronic
1092943013 12:13427968-13427990 TGGGAGAATCAGGATTGGCGGGG + Intergenic
1093574490 12:20711008-20711030 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1093685536 12:22049622-22049644 TAGAAGAAATAAAATTGGCTGGG + Intronic
1093697102 12:22172859-22172881 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1095202679 12:39402806-39402828 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1095251930 12:39989185-39989207 TGGGTAAAGCAGAATTGGCATGG - Intronic
1095372752 12:41489144-41489166 TGGGAGAAGAAGAATTGTCTTGG - Intronic
1096282235 12:50266117-50266139 TTTGAGAAGTAGAATTGGTTTGG - Intronic
1096532647 12:52251319-52251341 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1096937058 12:55292418-55292440 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1097738742 12:63213152-63213174 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1097830285 12:64217405-64217427 TAGAAGAAGAAGAATTGTCTTGG + Intronic
1097849065 12:64393814-64393836 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1098323793 12:69279126-69279148 TAAGAGAAGCCAAATTGGTTGGG - Intergenic
1099050808 12:77779789-77779811 TAGGAGAAGCAGGAGAGGCCTGG + Intergenic
1100532371 12:95472540-95472562 TTGGAGAAGTAGATATGGCTGGG + Intergenic
1101074419 12:101113689-101113711 TAAGAGTAGCAGAATTGTCAAGG + Intronic
1101189887 12:102321656-102321678 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1102214273 12:111149315-111149337 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1102837611 12:116080080-116080102 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1104391314 12:128392721-128392743 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1104788309 12:131466068-131466090 TGGAAGAAGAAGAATTGTCTCGG + Intergenic
1105300379 13:19128605-19128627 TAGAAGGAGGAGAATTGGCCTGG - Intergenic
1105833143 13:24183665-24183687 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1106054502 13:26225921-26225943 TAGAGGAAGCAGGATTGGCCAGG + Intergenic
1106058494 13:26262507-26262529 CAGGAGAAGCAAAATTTGATGGG + Intronic
1106105197 13:26726831-26726853 TCGAAGAAGAAGAATTGTCTGGG + Intergenic
1106290126 13:28353275-28353297 TAAGAGTATCAGATTTGGCTGGG + Intronic
1106788866 13:33134215-33134237 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1107011907 13:35678497-35678519 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1107445427 13:40466220-40466242 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1108722472 13:53146153-53146175 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1109229956 13:59744576-59744598 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1109794125 13:67287622-67287644 TAGGAGATGCAGTAGTGGCCAGG - Intergenic
1109890844 13:68612382-68612404 CATGAGAAGAAGAATTGTCTTGG + Intergenic
1110357192 13:74580585-74580607 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1110527313 13:76553887-76553909 TAGGCTAAGCATGATTGGCTGGG - Intergenic
1110718408 13:78733630-78733652 CAGGAGAAGGAGAGGTGGCTTGG + Intergenic
1110776303 13:79411928-79411950 GGGGGGAAGCAGAATTGGGTGGG - Intergenic
1111707743 13:91772075-91772097 TATGAGAATCAGATTGGGCTCGG - Intronic
1112068210 13:95817421-95817443 CAGGAGAAACAAAATTAGCTGGG + Intronic
1112323115 13:98424952-98424974 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1112467190 13:99654463-99654485 TGGGAGAAGAAGATTTGGGTTGG - Intronic
1112590271 13:100757079-100757101 TGGCAGAAGCAGAAGGGGCTCGG + Intergenic
1114873282 14:26684205-26684227 TAGGAGAATCATTATTGGATAGG - Intergenic
1115209784 14:30954763-30954785 AAGGAGAGTCAGAATTGGCTAGG - Intronic
1115696674 14:35906757-35906779 TAGAAGACGAAGAATTGTCTTGG - Intronic
1115831752 14:37350370-37350392 AAGAAAAAGCAGAATGGGCTGGG - Intronic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1117025801 14:51618723-51618745 TAGGAGAAACAGGTTTGGGTGGG + Intronic
1117996538 14:61483321-61483343 GGGGAGAGGCAGAATTGGGTGGG - Intronic
1118391696 14:65301221-65301243 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1118419013 14:65578608-65578630 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1119148326 14:72335675-72335697 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1119308370 14:73626203-73626225 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1119356740 14:74013551-74013573 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1120066989 14:80053945-80053967 TAGAAGAAGAATAATTGTCTTGG + Intergenic
1120523710 14:85553415-85553437 TGGAAGAAGAAGAATTGTCTGGG + Intronic
1120701623 14:87704860-87704882 TGGAAGAAGCAGAGTTGGCCTGG - Intergenic
1121246671 14:92465713-92465735 TAGGGGAGGCAGCCTTGGCTTGG - Intronic
1121396004 14:93623928-93623950 TAGAAGAAATGGAATTGGCTAGG + Intronic
1121716048 14:96076553-96076575 TGGAAGAAGAAGAATTGCCTTGG + Intronic
1122530604 14:102423530-102423552 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1122937093 14:104965113-104965135 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1125022371 15:34997954-34997976 TGGAAGAAGAAGAATTGCCTTGG + Intergenic
1125258784 15:37798391-37798413 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1125296981 15:38213815-38213837 TTGGAGAAACACAAGTGGCTTGG + Intergenic
1125380985 15:39086381-39086403 AAGGAAAAGCAGAATTGATTTGG + Intergenic
1125469529 15:39989403-39989425 TGGTAGAAGCAGAATTTGCAAGG + Intronic
1125841651 15:42806875-42806897 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1125843056 15:42823790-42823812 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1126255277 15:46617972-46617994 GAAAAGAAGCAGAATTGGGTAGG + Intergenic
1126698609 15:51347474-51347496 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1126715063 15:51506746-51506768 TAAAATAAGCAGAATTGGCTGGG - Intronic
1126896359 15:53261236-53261258 TAGGAGAAGCAGACTGGTATAGG + Intergenic
1126987125 15:54325021-54325043 TAGAAAAAGAAGAATTGTCTTGG - Intronic
1127048704 15:55056765-55056787 TAGGAGAAAAATAATTGACTAGG + Intergenic
1127467196 15:59255636-59255658 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1128606947 15:69043634-69043656 TAGGAGAAGCAGAACGTTCTCGG + Intronic
1129375191 15:75125899-75125921 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1129839472 15:78734873-78734895 CAGGAGCAGCAGAAGAGGCTGGG + Intergenic
1130097321 15:80865708-80865730 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1130896954 15:88178385-88178407 TAGGAAAAGAAGAGGTGGCTAGG - Intronic
1130949644 15:88575388-88575410 TTGGAGAAGCAGGATTTTCTGGG + Intergenic
1131788580 15:95939508-95939530 TAGTAGAAGGGGAACTGGCTAGG + Intergenic
1132220339 15:100100564-100100586 TAGAAGAGTCAGAAATGGCTTGG - Intronic
1132760319 16:1505784-1505806 TAGGAGACCCAGACTGGGCTTGG + Intronic
1133519811 16:6545992-6546014 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1134155118 16:11836767-11836789 TAGGAGAAACAGAAGTTTCTTGG - Exonic
1134765506 16:16754106-16754128 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1134980544 16:18605106-18605128 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1135334163 16:21586779-21586801 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1135839029 16:25856583-25856605 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1137241720 16:46660848-46660870 TAAAACAAGCAAAATTGGCTCGG + Intronic
1137305119 16:47191457-47191479 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1137656861 16:50167150-50167172 TAGAAGAAGAAGAATTGTCTTGG + Intronic
1138128861 16:54461415-54461437 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1138222198 16:55261342-55261364 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1138323965 16:56145414-56145436 TAGAAGAAGAAGAATTGTCTTGG - Intergenic
1138853896 16:60664078-60664100 TAGGAATAACAGAATAGGCTGGG + Intergenic
1139130121 16:64132924-64132946 CAGGAGAAACACATTTGGCTTGG + Intergenic
1139173550 16:64660522-64660544 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1140048381 16:71457883-71457905 CAGGAGAAGCTGGACTGGCTGGG + Intronic
1140133137 16:72181905-72181927 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1140207558 16:72946234-72946256 CAGGCCAAGCAGAGTTGGCTTGG + Intronic
1140672190 16:77290360-77290382 TTGGGGGAGCAGATTTGGCTGGG + Intronic
1141571401 16:84936023-84936045 AAGAAGAAGTAGAATTGGATTGG + Intergenic
1143251611 17:5527186-5527208 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1144096008 17:11901364-11901386 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1145093236 17:20003100-20003122 TAAAAAAAGCAAAATTGGCTGGG + Intergenic
1145832499 17:27928273-27928295 TGGAAGAAGAAGAATTGCCTTGG - Intergenic
1146317925 17:31822999-31823021 TAGGAAAGGCTGAATAGGCTGGG - Intergenic
1146714938 17:35077801-35077823 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1146795503 17:35777440-35777462 TAGGTGAAGCAGAATTGGTTTGG + Intronic
1146983280 17:37186550-37186572 TAGGAGCACCAGAACTGGGTTGG + Intronic
1146992824 17:37290755-37290777 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1148631299 17:49111412-49111434 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1149473655 17:56940544-56940566 TAGGATCAGCAGATTTGGCCTGG - Intronic
1149809956 17:59658950-59658972 AAGGAGTAGTAGAATTGGCAGGG + Intronic
1150843237 17:68629049-68629071 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1150943076 17:69714392-69714414 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1152050431 17:77970726-77970748 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1152647529 17:81476412-81476434 CAAGAGAAGCAGAACCGGCTAGG - Intergenic
1153724146 18:7937701-7937723 TAGGAGTTGCAGAATGGTCTAGG + Intronic
1154022177 18:10673842-10673864 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1154061404 18:11063969-11063991 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1156948826 18:42868371-42868393 TGGGAGAGGGAGAAATGGCTAGG + Intronic
1157313609 18:46570683-46570705 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1157958044 18:52120975-52120997 TGGAAGAAGTAGAATTGTCTTGG + Intergenic
1158092931 18:53736677-53736699 TAAAAGAATAAGAATTGGCTGGG - Intergenic
1158093398 18:53742099-53742121 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1158165356 18:54533671-54533693 TGGGAGAAGGAGAGGTGGCTAGG + Intergenic
1158240853 18:55376499-55376521 TATGAAAAGAAGAATTGGGTTGG - Intronic
1158386986 18:57005748-57005770 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1158511678 18:58095980-58096002 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1158680688 18:59563835-59563857 GAGGGGAAACAGCATTGGCTGGG + Intronic
1159039162 18:63306901-63306923 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1159115647 18:64110026-64110048 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1159366190 18:67468436-67468458 TATGGGAAGAAGAATTGGCATGG + Intergenic
1159652325 18:70992184-70992206 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1160120921 18:76129936-76129958 GAGGAGCAGCAGACCTGGCTGGG - Intergenic
1160175984 18:76594627-76594649 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1160227718 18:77024301-77024323 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160617985 18:80148310-80148332 TGGGAGAGGCAGATTAGGCTGGG + Intronic
1160794787 19:940232-940254 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1164264552 19:23601716-23601738 TATAAGAAGTAGAATTGGCCAGG - Intronic
1166233378 19:41439003-41439025 TCGAAGAAGAAGAATTGTCTTGG - Intronic
1166925970 19:46267886-46267908 TGAAAGAAGAAGAATTGGCTGGG - Intergenic
1167802386 19:51752773-51752795 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1168407431 19:56118263-56118285 TGGGAGAAGCACAAGTGGCTCGG - Intronic
926123593 2:10257817-10257839 TCGGAGAAGCAGCTTTGGCTGGG - Intergenic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926907067 2:17816010-17816032 TTGGAGAAGCAGCATGGTCTAGG - Intergenic
927474908 2:23405810-23405832 GAGGTCAAGCAGAATGGGCTGGG + Intronic
927552905 2:24014452-24014474 TGGAAGAAGAAGAATTGTCTTGG - Intronic
927639505 2:24837912-24837934 TGGAAGAAGAAGAATTGTCTCGG - Intronic
927804211 2:26131208-26131230 GTGGAGAAGAAGAATTGTCTTGG + Intronic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
929763133 2:44822477-44822499 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
929850234 2:45580976-45580998 AAGAAGTAGAAGAATTGGCTGGG - Intronic
930395716 2:50821337-50821359 TGGAAGAAGAAGAATTGTCTTGG - Intronic
930880417 2:56263940-56263962 TGGAAGAAGAAGAATTGTCTTGG + Intronic
930906044 2:56569231-56569253 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
931035491 2:58238212-58238234 TGGAAGAAGAAGAATTGTCTTGG - Intronic
932810166 2:74818656-74818678 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
934869283 2:97846719-97846741 TGGAAGAAGAAGAATTGTCTTGG - Intronic
935094581 2:99932263-99932285 TGGAAGAAGAAGAATTGTCTTGG - Intronic
935786526 2:106553926-106553948 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
936672973 2:114681064-114681086 TAGTTGGAGCAGAATTGGGTAGG - Intronic
937410714 2:121672624-121672646 TAAAAGATGCAGAATGGGCTGGG + Intergenic
938075721 2:128334041-128334063 TGGAAGAAGAAGAATTGCCTTGG - Intergenic
938103659 2:128514896-128514918 TGGGAGGAGCAGACGTGGCTGGG - Intergenic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
939543497 2:143522631-143522653 TGGAAGAAGAAGAATTGTCTTGG + Intronic
939974591 2:148702889-148702911 TGGAAGAAGAAGAATTGTCTTGG - Intronic
939977666 2:148737746-148737768 TGGAAGAAGAAGAATTGCCTTGG + Intronic
940280703 2:151986775-151986797 TAGGAGAATCAGACTGGGCCAGG - Intronic
940317371 2:152339248-152339270 TGGAAGAAGAAGAATTGTCTTGG - Intronic
940462709 2:153987242-153987264 TGTGGGAAGAAGAATTGGCTGGG + Intronic
940994141 2:160128821-160128843 GAGGAGAAGCAGCTTTGGGTGGG + Intronic
941461950 2:165782311-165782333 TAGAAGAAGAAGGATTGTCTTGG + Intronic
941617134 2:167733469-167733491 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
942283143 2:174387936-174387958 TGGAAGAAGAAGAATTGTCTTGG + Intronic
942549313 2:177098013-177098035 TGGAAGAAGCAGATTTGTCTTGG + Intergenic
942552825 2:177137433-177137455 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
942767012 2:179469227-179469249 TGGAAGAAGAAGAATTGTCTTGG + Intronic
942846664 2:180434746-180434768 TTGGAGAAGCTGAATTAACTAGG - Intergenic
943146763 2:184055628-184055650 TTGGAAAAGAAGAAGTGGCTGGG - Intergenic
943236537 2:185328234-185328256 TAAGAGATACAAAATTGGCTGGG - Intergenic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943985495 2:194612557-194612579 TAGAAGAATAAGAATTGTCTTGG - Intergenic
944443052 2:199761989-199762011 TGGAAGAAGAAGAATTGTCTTGG + Intronic
945512489 2:210719858-210719880 CAGCAGAAGCAGCATTGCCTGGG - Intergenic
945917969 2:215724661-215724683 TAGAAGAAGAAGAATTGTCTTGG - Intergenic
945966396 2:216191958-216191980 TAGAGGAAGCAAAATTGGTTTGG + Intronic
946186729 2:217985128-217985150 TGGGAAAAGAAGAATTGTCTTGG - Intronic
946424974 2:219589620-219589642 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
946494510 2:220182241-220182263 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
947186318 2:227458711-227458733 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
947410033 2:229827886-229827908 TGGAAGAAGAAGAATTGTCTTGG - Intronic
948012141 2:234657426-234657448 TGGGAGAAGAGGAATTGTCTTGG - Intergenic
948363280 2:237437602-237437624 TCAGAGAAGCAGCACTGGCTGGG + Intergenic
948433061 2:237932745-237932767 TGGAAGAAGGAGAATTGTCTTGG - Intergenic
948734955 2:239996861-239996883 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1170406340 20:16041976-16041998 TAGGAGAACCAGAATTGGTTAGG + Intronic
1170704815 20:18735994-18736016 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1170912189 20:20583837-20583859 TCTGAGAAGCAGAAGTGTCTAGG - Intronic
1171234608 20:23514055-23514077 GAGGAGAAGCAGATTTGGGCAGG - Intergenic
1172154585 20:32814897-32814919 AAAAAGAAGAAGAATTGGCTGGG + Intergenic
1172238162 20:33392528-33392550 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1172744283 20:37194608-37194630 TAGGAGAAGTTGAATTGACGAGG + Intronic
1173025644 20:39305257-39305279 TGAGAGAAGCAGGATGGGCTGGG + Intergenic
1173363538 20:42365594-42365616 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1174199643 20:48798333-48798355 TAGGAGCAGCAAGATTGGTTAGG - Intronic
1174548228 20:51342474-51342496 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1174724815 20:52850632-52850654 AAGGATATGAAGAATTGGCTAGG - Intergenic
1175532074 20:59680717-59680739 TAGAAAAAGAAGAATTGTCTTGG - Intronic
1177365447 21:20129444-20129466 TGGAAGAAGAAGAATTGCCTTGG - Intergenic
1177412442 21:20747672-20747694 TATTAGAAGCAGAATTGCCTAGG - Intergenic
1177691217 21:24510143-24510165 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1178279676 21:31270779-31270801 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1178337176 21:31753715-31753737 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1178977080 21:37229234-37229256 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1179087697 21:38234319-38234341 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1179578176 21:42320775-42320797 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1181262113 22:21605962-21605984 CAAGAGAAGCAGATTTGGCTGGG - Intronic
1181921829 22:26326813-26326835 GAGGGGCAGCAGCATTGGCTTGG + Intronic
1182702242 22:32249957-32249979 TAGAAGAAGAAGAATTATCTTGG - Intronic
1182750150 22:32634991-32635013 TAGAAGAAGAAGAATTGTCTAGG - Intronic
1183491202 22:38116557-38116579 TAGAAAAAGGAGAATCGGCTGGG + Intronic
1183844392 22:40528930-40528952 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1183878543 22:40805563-40805585 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1184003921 22:41695115-41695137 TGGGAGAATCAGAACTGGATTGG + Exonic
1184659687 22:45960147-45960169 AAGGAGAAGCAGCCTGGGCTGGG - Intronic
1185010683 22:48311438-48311460 TAGAACAAGAAGAATTGTCTTGG + Intergenic
949634274 3:5965811-5965833 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
951629257 3:24700456-24700478 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
951994089 3:28707665-28707687 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952279767 3:31911546-31911568 TGGAAGAAGAAGAATTGTCTTGG + Intronic
953138006 3:40200207-40200229 TGGAAGAAGAAGAATTGTCTTGG + Intronic
953199474 3:40766147-40766169 AAAGAGAAACAGAAGTGGCTTGG - Intergenic
954152706 3:48665614-48665636 TAAGAGAAGGAGGATAGGCTGGG - Intergenic
955330805 3:58045523-58045545 TGGAAGAAGAAGAATTGTCTTGG - Intronic
955494533 3:59518049-59518071 TAGGGGAAGCAAGACTGGCTTGG + Intergenic
956281759 3:67564758-67564780 TAGTGGAAGAAGAATTGTCTTGG - Intronic
956475416 3:69614434-69614456 TGGAAGGAGCAGAATTGTCTTGG - Intergenic
956848927 3:73210573-73210595 TAGGAAAATCAGAAGTGTCTTGG - Intergenic
957352504 3:79044061-79044083 TGGAAGAAGCAGAATTGTCTTGG + Intronic
957839813 3:85653539-85653561 TAGGAGAAGCATATTTGTCAGGG + Intronic
958594066 3:96199754-96199776 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
958814942 3:98904095-98904117 TACAAGAAGGAGAATTGGTTTGG + Intergenic
959069248 3:101687264-101687286 TAAGAGAGGCAGAATGGGCCGGG - Intergenic
959913247 3:111788805-111788827 TGGAAGAAGAAGAATTGTCTTGG - Intronic
960076853 3:113496127-113496149 TGGAAGAAGAAGAATTGTCTTGG - Intronic
960198620 3:114803041-114803063 GAGGAGAAGGAGAAATGGCATGG - Intronic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
961846572 3:129769608-129769630 TGGAAGAAGAAGAATTGTCTTGG - Intronic
962856074 3:139345980-139346002 TAGGAGAAGAAGAGGTGACTAGG + Intronic
963325103 3:143853533-143853555 TAGGAGAAGCTGAATACGCTTGG + Intergenic
963769834 3:149378646-149378668 TCAGAGAAACAGAACTGGCTAGG + Intergenic
963843656 3:150133107-150133129 TGGAAGAAGTAGAATTGTCTTGG - Intergenic
963933280 3:151026399-151026421 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
964840761 3:160991014-160991036 TGGAAGAAGAAGAATTGTCTTGG + Intronic
964863703 3:161230526-161230548 AGGGAGAAGAATAATTGGCTGGG + Intronic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
965311971 3:167139503-167139525 TAGAACAACCAGAATTGGCCTGG - Intergenic
965371101 3:167863460-167863482 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
965964103 3:174466334-174466356 TGGAAGAAGAAGAATTGTCTTGG - Intronic
965990634 3:174813210-174813232 TGGAAGAAGAAGAATTGTCTTGG + Intronic
966176250 3:177140948-177140970 TGGAAGAAGAAGAATTGTCTTGG - Intronic
966268037 3:178070415-178070437 TGGGGGAAGCAGAATTGGCAAGG + Intergenic
966365488 3:179182370-179182392 TAAGAGTGGCAGTATTGGCTGGG + Intronic
966741479 3:183238618-183238640 TGGAAGAAGAAGAATTGTCTTGG - Intronic
967301477 3:188018647-188018669 TAGGAGAAGGTAAAGTGGCTAGG + Intergenic
967533120 3:190571898-190571920 TGGAAGAAGAAGAATTGTCTTGG - Intronic
967819655 3:193829275-193829297 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
968411419 4:394284-394306 CATTAGAAGCAGAATTGTCTTGG + Intergenic
970221340 4:13815059-13815081 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
970693635 4:18648486-18648508 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
970715600 4:18918683-18918705 TTCGAGAAGCAGAAATAGCTGGG - Intergenic
971209952 4:24606581-24606603 TGGAAGAAGAAGAATTGCCTTGG + Intergenic
971829220 4:31668918-31668940 TAGGAAAATCTGATTTGGCTTGG - Intergenic
971907804 4:32750169-32750191 TGGAAGAAGCAGAATTCACTTGG + Intergenic
972025034 4:34365080-34365102 TAAGAGATGCTGAAGTGGCTGGG + Intergenic
972100317 4:35407466-35407488 TAGGAGAAACAAAAATGGTTTGG + Intergenic
972300980 4:37785390-37785412 TAGGAGAGGAAGAATTAGCAGGG + Intergenic
972329108 4:38047375-38047397 CAGGAGCAGCAGCATTGCCTTGG - Intronic
972331698 4:38069927-38069949 CAGCAGAAGAAGAATTGTCTTGG - Intronic
972365111 4:38367293-38367315 TGGAAGAAGAAGAATTGCCTTGG + Intergenic
972457215 4:39266312-39266334 TGGAAGAAGAAGAATTGTCTTGG + Intronic
974832803 4:67210439-67210461 AAGGAGATGCAGAACTTGCTGGG + Intergenic
974842105 4:67310378-67310400 TAGCTGGAGCTGAATTGGCTAGG - Intergenic
974978705 4:68925097-68925119 TGGGAAAAGAAGAATTGCCTTGG - Intergenic
975003374 4:69255008-69255030 TGGGAAAAGAAGAATTGCCTTGG + Intergenic
975605495 4:76150146-76150168 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
975660621 4:76685302-76685324 TGGAAGAAGAAGAATTGTCTTGG + Intronic
976426265 4:84906832-84906854 TGGGAGAAGAAGAATTGTCTTGG - Intronic
977055526 4:92185594-92185616 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
977487010 4:97661792-97661814 TAGGAAAAGTAGCATTGGATTGG - Intronic
978840235 4:113203794-113203816 TATGAGAAGCAATATTGCCTGGG - Intronic
979216421 4:118170038-118170060 AGGCAGAAGCAGAATTGCCTTGG + Intronic
979358228 4:119730815-119730837 CAGGAGAAGAAGACCTGGCTAGG + Intergenic
979491971 4:121338565-121338587 TGGAAGAAGAAGAATTGCCTTGG - Intronic
980028163 4:127791301-127791323 TGGAAGAAGAAGAATTGTCTTGG + Intronic
980799308 4:137728517-137728539 TGGAAGAAGAAGAATTGCCTTGG - Intergenic
981018724 4:140003200-140003222 TAGTAAAAGCAGAACTGGCCTGG - Intronic
982543342 4:156703609-156703631 TAGAAGAATAAGAATTGTCTTGG - Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
983486327 4:168335186-168335208 TAGAAGAGGAAGAATTGTCTTGG + Intergenic
983875116 4:172866326-172866348 AAGGAGAAGGAGCATAGGCTAGG + Intronic
984133322 4:175905438-175905460 TGGAAGAAGAAGAATTGTCTTGG - Intronic
984158231 4:176219962-176219984 TGGAAGAAGAAGAATTGTCTTGG + Intronic
984253033 4:177357421-177357443 TGGAAGAAGAAGAATTGTCTTGG - Intronic
985210928 4:187593563-187593585 TAAGAAAAGCAAACTTGGCTGGG + Intergenic
985251333 4:188027473-188027495 AAGAAAAAGCAGAACTGGCTTGG + Intergenic
985559075 5:573074-573096 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
987098324 5:14569894-14569916 TGGGAGAAGAAGAATTGTCTTGG - Intergenic
987565607 5:19581136-19581158 TAAGAGAAGCCCAATTGCCTGGG - Intronic
988492896 5:31719950-31719972 CAGCAGAGGCAGAATTGGCCTGG + Intronic
988932864 5:36053972-36053994 TGGAAGAAGAAGAATTGTCTTGG + Intronic
989057058 5:37376064-37376086 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
989270346 5:39525914-39525936 TAGTCAAAACAGAATTGGCTGGG - Intergenic
989979249 5:50623074-50623096 TAGGAGAAGGTTAATTGGCATGG - Intergenic
990983832 5:61624238-61624260 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
990986127 5:61642495-61642517 TAGGAGAAGTGGAAGTAGCTAGG - Intronic
991684520 5:69169350-69169372 TATAAGAAGCTGAACTGGCTGGG - Intronic
991697251 5:69284762-69284784 TGGAAGAAGAAGAATTGTCTTGG + Intronic
992321838 5:75621102-75621124 TAGGGGTAGCAGCAGTGGCTGGG - Intronic
992552394 5:77871031-77871053 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
992643607 5:78791965-78791987 TGGAAGAAGAAGAATTGTCTTGG + Intronic
992747193 5:79831454-79831476 CAGGAGAAGCAGGAGTGCCTGGG - Intergenic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
994047522 5:95326604-95326626 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
995075099 5:107973420-107973442 TGGAAGAAGAAGAATTGTCTTGG - Intronic
995128420 5:108603729-108603751 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
996833382 5:127764672-127764694 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
997324215 5:133006242-133006264 TATAAAAAGAAGAATTGGCTGGG - Intronic
997750137 5:136336474-136336496 AATGAGAAGCAGAAAGGGCTAGG + Intronic
998240534 5:140439340-140439362 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1000131449 5:158304259-158304281 TGGGAGAATCAGACTGGGCTGGG + Intergenic
1000423572 5:161064309-161064331 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1000586056 5:163100463-163100485 TAGGAGGAGCAGGCATGGCTGGG - Intergenic
1000731482 5:164839262-164839284 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1001238060 5:170046369-170046391 CAGTACAAGCAGGATTGGCTGGG - Intronic
1001445295 5:171778062-171778084 TAAGACAAGGAGATTTGGCTGGG + Intergenic
1001960226 5:175875715-175875737 TAAGAAAAGGAGAATTGGTTGGG + Intronic
1003248455 6:4403644-4403666 TAGGGGAAGAAGAGGTGGCTGGG + Intergenic
1003877639 6:10452300-10452322 AAGGGGGAGCAGCATTGGCTGGG + Intergenic
1003906628 6:10706498-10706520 TGGGAGAGGAAGAAGTGGCTGGG - Intronic
1004159217 6:13198557-13198579 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1004178604 6:13362165-13362187 TAGAAGAACCAGAATCAGCTGGG + Exonic
1004627392 6:17389867-17389889 TGGAAGAAGGAGAATTGTCTTGG - Intergenic
1004872606 6:19922488-19922510 TAGGAGGAGAAGGACTGGCTAGG + Intergenic
1005347687 6:24906573-24906595 TAGGAGGAGCACAATTGAGTTGG - Intronic
1005356305 6:24986854-24986876 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1005654038 6:27913884-27913906 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1005738360 6:28769606-28769628 TAGGAGGAGCAAAACTGGCCCGG - Intergenic
1005747815 6:28855304-28855326 TAGAAAAAGGACAATTGGCTGGG - Intergenic
1006701040 6:35973608-35973630 TGGAAGAAGGAGAATTGTCTTGG - Intronic
1007163858 6:39814247-39814269 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1007281959 6:40719491-40719513 TAGGAGAGGCAGAAGGGCCTTGG - Intergenic
1007546163 6:42696281-42696303 GAGGAGAAGAAAAAATGGCTTGG + Intergenic
1007681878 6:43639432-43639454 TAGAAGATGAAGAGTTGGCTGGG - Intronic
1007999229 6:46341334-46341356 TTGAAGAAGAAGAATTGTCTTGG + Intronic
1008390316 6:50943285-50943307 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1008423369 6:51328766-51328788 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1009505379 6:64470538-64470560 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1009910282 6:69917760-69917782 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1009974957 6:70662673-70662695 GGGGAGAAGCAGCATTTGCTTGG - Intergenic
1010054932 6:71554222-71554244 TAAGAAAATCAAAATTGGCTGGG - Intergenic
1010565024 6:77400455-77400477 TAGGTGAAGGAGAACTAGCTGGG - Intergenic
1011287006 6:85735578-85735600 TAAAAGAACCAGTATTGGCTAGG - Intergenic
1011417372 6:87136925-87136947 TAGGAGAAGCGGGGTTGGGTGGG - Intergenic
1011842602 6:91520368-91520390 TAAAAGAAACAAAATTGGCTGGG - Intergenic
1012306118 6:97659896-97659918 TAGAAGAAGAAGAATTGTCGTGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014020962 6:116589291-116589313 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1014244996 6:119058497-119058519 TAAGAGAAGGAGAATTGGGCTGG - Intronic
1014419648 6:121226988-121227010 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1014711995 6:124817298-124817320 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1014734380 6:125075206-125075228 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1016247250 6:141997143-141997165 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1016336412 6:143009693-143009715 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1016356758 6:143227051-143227073 TGGAAGAAGAAGAATTGCCTTGG - Intronic
1017074967 6:150609543-150609565 TGGGAGAAGCAGGCATGGCTGGG + Intronic
1017184593 6:151588238-151588260 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1017251098 6:152280489-152280511 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1017340317 6:153313654-153313676 TAGGAGAAAGAGCACTGGCTAGG - Intergenic
1017370235 6:153696919-153696941 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1017867481 6:158456453-158456475 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1018666587 6:166143986-166144008 TGTAAGAAGCAGAATTGTCTTGG - Intergenic
1018722024 6:166580412-166580434 TGGAAGAAGCAGCATTGTCTTGG + Intronic
1019221475 6:170476649-170476671 TAGAAGAGGCAGCATGGGCTTGG + Intergenic
1019979403 7:4610148-4610170 AAGAAGAAGAAGAATTAGCTGGG + Intergenic
1020379088 7:7522742-7522764 TGGAAGAAGAAGAATTGCCTTGG + Intronic
1021292465 7:18863502-18863524 TAGAAGACGAAGAATTGCCTTGG - Intronic
1022053460 7:26703169-26703191 CAGAAGAAGAAGAATTGTCTTGG + Intronic
1022068137 7:26882536-26882558 TAAAAGAAGCAGAATAGGCTGGG + Intronic
1022087536 7:27083128-27083150 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1022168190 7:27794397-27794419 CAGTAGAGGCAGAAGTGGCTGGG - Exonic
1023178092 7:37453169-37453191 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1023216683 7:37870179-37870201 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1023294045 7:38696880-38696902 TGGGAGAAGCACAAGTGGCTCGG + Intergenic
1023915550 7:44586140-44586162 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1024395009 7:48856152-48856174 TATAAGAAGAAGAATTGTCTTGG - Intergenic
1024400260 7:48916524-48916546 TATAAGAAGAAGAATTGTCTTGG + Intergenic
1024842519 7:53603451-53603473 TAGGAGGAGCAGAGGTGGATGGG - Intergenic
1026259454 7:68741593-68741615 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1028386520 7:90260138-90260160 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1028721942 7:94043054-94043076 AAGGAGAAGAAGAATTTGCAGGG - Intergenic
1029349685 7:100004265-100004287 AAGAAGAAACAGTATTGGCTGGG - Intergenic
1029424784 7:100488744-100488766 TTCGGGAAGCAGACTTGGCTTGG - Exonic
1029547954 7:101221133-101221155 CAGGAGAAGCAGACTTGGATGGG + Intronic
1030017186 7:105235059-105235081 TGGAAGAAGAAGAATTGGCTTGG - Intronic
1030105244 7:105981785-105981807 TAGGAGAAGCAGATTTGGGTGGG - Intronic
1030287195 7:107838787-107838809 TAGAAGAAGAAGAATGGTCTTGG - Intergenic
1030836057 7:114287184-114287206 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1031046344 7:116892582-116892604 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1031477164 7:122237197-122237219 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
1032317283 7:130850341-130850363 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1032753475 7:134865617-134865639 TAGGAGAAAAAGAATTTGCGTGG + Intronic
1032820110 7:135516592-135516614 TAGAAGAAGAATAATTGTCTTGG - Intergenic
1032855595 7:135830953-135830975 AAGGAGGAGCAGAATTGGACTGG + Intergenic
1033218621 7:139512782-139512804 TAGAAGAAGCAGAAAGGGCTGGG - Intergenic
1035981394 8:4375960-4375982 TGGGATAAGCAGCATTGGCAAGG - Intronic
1036671751 8:10793386-10793408 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1036957593 8:13205546-13205568 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1037329058 8:17725830-17725852 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1037543994 8:19899903-19899925 TGGGAGAAGCAGCATTGCCAAGG + Intergenic
1038163305 8:25061199-25061221 GAGGAGAGGCAGAGCTGGCTGGG - Intergenic
1039100507 8:33936797-33936819 TAGGTGAAGCAGAATTTGGTGGG + Intergenic
1040574066 8:48635505-48635527 TAAGTGAAGCAGAATTGGTCAGG - Intergenic
1042366341 8:67941062-67941084 TGGCAGAAGAAGAATTGTCTTGG - Intergenic
1042451508 8:68952677-68952699 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1042718660 8:71803540-71803562 TGGGAGAAGAATAATTGCCTTGG - Intergenic
1042955933 8:74250674-74250696 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1043225216 8:77719014-77719036 AAGGAGAAGCAGAATTTCCAAGG + Intergenic
1043751053 8:83934665-83934687 TAGTAGAAGCAGCATTAACTAGG + Intergenic
1044775171 8:95679268-95679290 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1044801559 8:95962324-95962346 TAGAAGTAGCAGGGTTGGCTGGG - Intergenic
1044819869 8:96148741-96148763 TGGGAGAGGTAGAATTGACTTGG - Intronic
1045584527 8:103517860-103517882 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1046476396 8:114750070-114750092 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1046638589 8:116700469-116700491 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1046734208 8:117758844-117758866 TATGAGAAGCTGAATTTGCATGG + Intergenic
1047249111 8:123168354-123168376 TGGAAGAAGGAGAATTGTCTTGG - Intergenic
1047768030 8:128005311-128005333 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1047842577 8:128769059-128769081 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1048424904 8:134313962-134313984 TAGTAGAAGAAGAATAGACTTGG + Intergenic
1048483823 8:134829309-134829331 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1048909883 8:139125133-139125155 TATGAGAAGCTGAGATGGCTGGG + Intergenic
1049161338 8:141099814-141099836 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1051414592 9:16825645-16825667 TAGGAGAAAAAGATTTTGCTTGG - Intronic
1051576211 9:18618756-18618778 TAAAAGAAGCTGACTTGGCTGGG - Intronic
1051818823 9:21141169-21141191 TGGGAGAAGGAGAATCTGCTGGG - Exonic
1052471925 9:28909077-28909099 TTTGAGAAGCAGAATTATCTGGG - Intergenic
1053234266 9:36438472-36438494 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1055448871 9:76411995-76412017 TAAAAGAAGCATAATTGGCCAGG - Intergenic
1055664127 9:78536162-78536184 TAGAAGAAGAATAATTGTCTTGG + Intergenic
1055677894 9:78683925-78683947 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1056125773 9:83535675-83535697 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1056156296 9:83841364-83841386 TAATAGAAGTAGAATTGGCTAGG - Intronic
1056354235 9:85782217-85782239 TAATAGAAGTAGAATTGGCTAGG + Intergenic
1056889197 9:90474068-90474090 AAGAAGAAGAAGAATTGTCTTGG + Intergenic
1057252982 9:93518980-93519002 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1057426498 9:94954394-94954416 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1057981264 9:99666147-99666169 TAGAAGAAGAAAAATTGTCTTGG + Intergenic
1058050993 9:100406272-100406294 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1058084022 9:100729959-100729981 CCAGAGAAGCAGACTTGGCTTGG - Intergenic
1058563101 9:106250450-106250472 TATGAAAAGAAGAATTGGCCAGG - Intergenic
1059147555 9:111914306-111914328 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1059347711 9:113641450-113641472 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1059368525 9:113806338-113806360 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1059521769 9:114949344-114949366 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1059975024 9:119707004-119707026 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1060652707 9:125343254-125343276 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1060817416 9:126642494-126642516 TGGGAGAAGCAGAGTTTGCCCGG - Intronic
1061411981 9:130426820-130426842 TGGAAGAAGAAGAATTGCCTTGG - Intronic
1062177753 9:135173605-135173627 AAGGGGGAGCAGACTTGGCTTGG + Intergenic
1185967888 X:4628408-4628430 TGGGAGAAGAAGCATTGTCTTGG - Intergenic
1186435771 X:9542239-9542261 TAGGAGAAGCACAGTTGGAAAGG - Intronic
1186780714 X:12909344-12909366 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1186844992 X:13521986-13522008 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1187095067 X:16139512-16139534 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1187404360 X:18989201-18989223 TAAGACAAACACAATTGGCTGGG - Intergenic
1187410889 X:19049681-19049703 TAGAATAAGAAGAATTGTCTTGG - Intronic
1187993055 X:24896557-24896579 TGGAAGAAGAAGAATTGTCTTGG - Intronic
1188359833 X:29239781-29239803 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1188472000 X:30551606-30551628 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1188478082 X:30608085-30608107 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1188596059 X:31901442-31901464 TAGCAGAAGCAAAATGGCCTTGG - Intronic
1188902537 X:35751644-35751666 TGGGAGAAGTAATATTGGCTTGG - Intergenic
1189086290 X:38028117-38028139 CAAGAGGAGAAGAATTGGCTGGG - Intronic
1189427493 X:40914256-40914278 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1190069416 X:47267153-47267175 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1190128928 X:47729223-47729245 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1190366907 X:49703732-49703754 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1191851321 X:65588272-65588294 GAGGAGAAGCAAAGTTGGCCAGG + Intergenic
1192549006 X:72038960-72038982 TTGTAGAAGCAGAAGTGGATTGG + Intergenic
1193054878 X:77139307-77139329 TAGTAGAAGGAGAACTGGGTTGG + Intergenic
1193329972 X:80224569-80224591 TAGGAGAAGCAGCATTGAAGAGG - Intergenic
1193536710 X:82725967-82725989 TGGGAGAAACAGAATTGTTTGGG + Intergenic
1194701655 X:97120681-97120703 TAGAAGAAGGAGAATTGTCTTGG - Intronic
1194959665 X:100220709-100220731 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1195716232 X:107821004-107821026 CAGGAGATGCAAAATTGGCTGGG - Intergenic
1195775510 X:108399809-108399831 TAGGAAAATCAGAGTAGGCTGGG - Intronic
1196158221 X:112454162-112454184 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1196272092 X:113724121-113724143 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1196948073 X:120848526-120848548 TAAAAGATACAGAATTGGCTGGG - Intergenic
1198070498 X:133143566-133143588 TGGAAGAAGAAGAATTGTCTTGG + Intergenic
1198131879 X:133703908-133703930 TGGAAGAAGAAGAATTGTCTTGG + Intronic
1198209550 X:134504322-134504344 TAGAAAAAGAAGAATTGTCTTGG + Intronic
1198691115 X:139285909-139285931 TGGAAGAAGAAGAATTGTCTTGG - Intergenic
1201342242 Y:12947182-12947204 TAGGAGAACCAGGATGGGCATGG - Intergenic
1201505882 Y:14699369-14699391 TGGAAGAAGAAGAATTGTCTTGG - Intronic