ID: 1139418206

View in Genome Browser
Species Human (GRCh38)
Location 16:66831256-66831278
Sequence CAGTGTGCTCACCTGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 1, 2: 6, 3: 82, 4: 705}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139418203_1139418206 21 Left 1139418203 16:66831212-66831234 CCACTTAACTGGCTGTGAGATCT 0: 1
1: 0
2: 4
3: 37
4: 235
Right 1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG 0: 1
1: 1
2: 6
3: 82
4: 705
1139418204_1139418206 -10 Left 1139418204 16:66831243-66831265 CCTCTCAAATCCTCAGTGTGCTC 0: 1
1: 0
2: 4
3: 67
4: 728
Right 1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG 0: 1
1: 1
2: 6
3: 82
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139418206 Original CRISPR CAGTGTGCTCACCTGTGCAG TGG Intronic
900608629 1:3535074-3535096 CAGTTTCCTCATCTGTGCATGGG + Intronic
900749814 1:4388250-4388272 CAGTTTTCTCATCTGTACAGTGG + Intergenic
901490654 1:9594809-9594831 CAGTGTCCACATCTGTGAAGTGG - Intronic
901677351 1:10893595-10893617 CAGTTTGCTCATCTGTACAATGG + Intergenic
901678955 1:10902191-10902213 CAATTTGCTCATCTGTCCAGTGG - Intergenic
902193679 1:14782002-14782024 CAGTGTCCTCATCTGTAAAGTGG + Intronic
902461165 1:16578130-16578152 CTGTTTCCTCACCTGTTCAGAGG - Intronic
902461947 1:16584411-16584433 CAGTTTCCTCACCTGTTCAGAGG - Intronic
902462726 1:16590776-16590798 CAGTTTCCTCATCTGTTCAGAGG - Intronic
902566835 1:17316880-17316902 CAGTGTGCTCATCTGTAAAATGG + Intronic
902617280 1:17630685-17630707 CAGTTTCCTCACCTGGGCAATGG + Intronic
902691864 1:18115015-18115037 CAGTGTCCTCACCTGTGGACTGG - Intronic
902805205 1:18857039-18857061 CAGTTTCCTCACCTGTAAAGTGG - Intronic
902809015 1:18877799-18877821 CAGTTTCCTCATCTGTGGAGTGG - Intronic
903178602 1:21594522-21594544 CAGTTTCCTCATCTGTGCAGTGG - Intergenic
903193098 1:21667773-21667795 CAGTTTCCTCACCTGTGCAATGG + Intronic
903214565 1:21836643-21836665 CAGTGTTCTCAGCTGTACAGTGG - Intronic
903321408 1:22545540-22545562 CAGTTTCCCCGCCTGTGCAGTGG + Intergenic
903360295 1:22772757-22772779 CAGTTTCCTCATCTGTACAGTGG + Intronic
903647795 1:24905266-24905288 CAGTTTTCTCATCTGTGAAGTGG - Intronic
903649954 1:24916330-24916352 CAGTGTGCTCAGCTGTCAAATGG - Intronic
903760520 1:25694924-25694946 CAGTCTACTCACCTGTGAAATGG + Intronic
903789876 1:25885542-25885564 CAGTTTACTCATCTGTGAAGAGG - Exonic
904040895 1:27584411-27584433 CAGTTTCCTCACCTGTTGAGGGG - Intronic
904342257 1:29844331-29844353 CAGTTTCCTCATCTGTACAGTGG + Intergenic
904402401 1:30265472-30265494 CAGTCTCCTCATCTGTGTAGTGG - Intergenic
904405484 1:30285660-30285682 CAGTTTCCTCACCTGTGCAATGG - Intergenic
904490512 1:30856093-30856115 CAGTTTTCTCACCTGTAAAGTGG + Intergenic
904836168 1:33338548-33338570 CAGTGTGCTGAGCTTGGCAGGGG - Intronic
904900860 1:33856042-33856064 CAGTTTCCTCATCTGTGCAATGG + Intronic
904936163 1:34131215-34131237 CAGTGTCCTCATCTGTAAAGTGG - Intronic
905271526 1:36790746-36790768 CAGTTTACTCACCTGTGCATTGG - Intergenic
905281853 1:36854289-36854311 CAGTTTCCTCATCTGTGCAATGG + Intronic
905282319 1:36857070-36857092 CAGTGTCCTCCTCTGTCCAGTGG - Intronic
905323809 1:37136281-37136303 CAGTGGTCTCATCTGTGCAATGG - Intergenic
905710431 1:40097568-40097590 CAGTGTCCTCACCTGTCAGGGGG - Exonic
906245617 1:44271578-44271600 CAGTTTCCTCACCTGTACAATGG + Intronic
906295138 1:44645016-44645038 CAGGCTCCTCGCCTGTGCAGGGG - Exonic
906696111 1:47824490-47824512 CAGTTTCCTCATCTGTGAAGTGG - Intronic
907304448 1:53505981-53506003 CAGTTTGCCCACCTGTCCATGGG + Intergenic
907317192 1:53579970-53579992 CAGTTTACTTACCTGTTCAGTGG - Intronic
907385981 1:54125567-54125589 CAGCTTTCTCACCTGTGAAGTGG + Intergenic
907401850 1:54229236-54229258 CTGTTTCCTCACCTGTGAAGTGG - Intronic
907514642 1:54985949-54985971 CAGTTTCCTCATCTGTGAAGTGG - Intronic
909356924 1:74720054-74720076 CAGTTTACTCATCTGTGTAGTGG - Intronic
909789939 1:79663458-79663480 CAGTGACCTCACCTGTGTAATGG - Intergenic
910114671 1:83718707-83718729 CAGTGTTCACACCTGAACAGAGG - Intergenic
912508746 1:110174358-110174380 CAGTCTCCTCATCTGTGAAGTGG - Intronic
912549827 1:110478200-110478222 CTGTTTGCTCACCTGTGAAATGG - Intergenic
912564199 1:110573926-110573948 CAGTTTGCTCACTGGTGAAGTGG - Intergenic
912713084 1:111963454-111963476 CAGTTTTCTCACCTGTAAAGTGG + Intronic
913031819 1:114914612-114914634 CAGTGTGCACAGATATGCAGAGG + Intronic
913053516 1:115137302-115137324 CAGTGTCCTCACCTGTAAATAGG + Intergenic
913568641 1:120098571-120098593 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
913602750 1:120437747-120437769 CAGTTTCCTCATCTGTTCAGAGG + Intergenic
913603498 1:120444100-120444122 CAGTTTCCTCATCTGTTCAGAGG + Intergenic
913604257 1:120450443-120450465 CAGTTTCCTCACCTGTTCAGAGG + Intergenic
913640352 1:120806814-120806836 CAGTTTCCTCATCTGTTCAGAGG + Intronic
913641129 1:120813154-120813176 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914084286 1:144438762-144438784 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914190305 1:145404033-145404055 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914212161 1:145589815-145589837 CAGTTTCCTCATCTGTTCAGAGG - Intergenic
914277354 1:146137170-146137192 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914278124 1:146143527-146143549 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914289455 1:146259592-146259614 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914363924 1:146961367-146961389 CAGTTTCCTCATCTGTTCAGAGG + Intronic
914364687 1:146967712-146967734 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914365453 1:146973999-146974021 CAGTTTCCTCACCTGTTCAGAGG + Intronic
914486992 1:148119440-148119462 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914487753 1:148125776-148125798 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914538402 1:148588118-148588140 CAGTTTCCTCACCTGTTCAGAGG - Intronic
914539170 1:148594475-148594497 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914550491 1:148710345-148710367 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914587328 1:149074585-149074607 CAGTTACCTCACCTGTTCAGAGG - Intronic
914588108 1:149080898-149080920 CAGTTTCCTCATCTGTTCAGAGG - Intronic
914627508 1:149477153-149477175 CAGTTTCCTCATCTGTTCAGAGG + Intergenic
915111973 1:153569645-153569667 CAGTGTTCTCCTCTGTGAAGTGG - Intergenic
915802506 1:158809125-158809147 CAGTGTCCTCTCCTTTGTAGAGG - Intergenic
915823256 1:159048336-159048358 CAGTTTTCTCACATGTGAAGTGG - Intronic
918453669 1:184685413-184685435 CAGTTTCCTCATCTGTGAAGCGG - Intergenic
919647919 1:200114563-200114585 CAGTGTCCTCACCTGTCCAGTGG + Intronic
919772545 1:201171660-201171682 CAGTTTTCTCACCTGCGCAGTGG + Intergenic
921070239 1:211652409-211652431 CAGTGTCCTCATCTGTGCAATGG - Intergenic
921168861 1:212527736-212527758 CAGTTTCCTCACCTATACAGTGG - Intergenic
921925423 1:220706764-220706786 CATCGTGCTCCCCTGTCCAGAGG - Intergenic
922576071 1:226661384-226661406 CAGTGTTCCCATCTGTGAAGTGG - Intronic
922800486 1:228362649-228362671 CAGTGAGGTCCCCTGTGGAGGGG - Exonic
923008597 1:230070986-230071008 CAGTTTCCTCATCTTTGCAGTGG + Intronic
923802579 1:237224894-237224916 CAGTTTCCTCACCTGTAAAGTGG - Intronic
924182173 1:241449889-241449911 CAGTGGTCACAGCTGTGCAGTGG + Intergenic
924776233 1:247115822-247115844 CACTGTGCTCACCAGTGCCTTGG + Intergenic
1063451205 10:6151477-6151499 CAGTGTCCTCACCAATGCAAGGG - Intronic
1063551640 10:7039449-7039471 CTGTGTCCTCACCTGGGGAGTGG - Intergenic
1063684859 10:8227409-8227431 CAGTTTGCTCACCTGTAAAATGG - Intergenic
1063854961 10:10239225-10239247 CAGTATGCTAACATGTGCAATGG + Intergenic
1064020994 10:11808986-11809008 CAGTTTCCTCATCTGTGCAATGG + Intergenic
1064220093 10:13432926-13432948 CAGTCTTCTCACCTGTGAAGTGG + Intergenic
1064332426 10:14406334-14406356 CAGTGTTCTCATCTGTGATGTGG - Intronic
1065961057 10:30734717-30734739 CAGTGGCCTCACCTGTGAAATGG + Intergenic
1066745777 10:38603598-38603620 TAGTGTGATCACCTCTGCAAAGG + Intergenic
1067052726 10:43031957-43031979 CAATGTTCTAACCTGTGTAGGGG + Intergenic
1067569036 10:47358399-47358421 CAGTTTGTTCACCTGTTCAATGG + Intergenic
1068060482 10:52063235-52063257 CAGTTTGTTTGCCTGTGCAGTGG - Intronic
1068678118 10:59788959-59788981 CAGTGTGCACAGATATGCAGAGG + Exonic
1068910772 10:62375811-62375833 CAGTGTTCTCTTCTGTGGAGAGG + Intronic
1069483441 10:68804853-68804875 CAGTGTTCTCACCTATGAAGTGG - Intergenic
1069526565 10:69177238-69177260 CAGTGTGTTCAGAGGTGCAGAGG + Intergenic
1069744699 10:70707692-70707714 CAATGTGTTCACCTGTGTAATGG + Intronic
1069823837 10:71243306-71243328 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1069860418 10:71467807-71467829 CAGTTTGCTCCTCTGCGCAGTGG - Intronic
1069870122 10:71527993-71528015 CAGTTTACCCATCTGTGCAGTGG + Intronic
1070571575 10:77643317-77643339 CAGTTTTCTCACCTGTAAAGTGG - Intergenic
1070599684 10:77857018-77857040 CAGTGTTCTCATCTGTGAAAGGG - Intronic
1070640055 10:78161810-78161832 CAGTTTGCTCACCTGTAATGCGG + Intergenic
1070646223 10:78204113-78204135 CAGTGTCCTCCTCTGTGCAGTGG + Intergenic
1070724900 10:78781191-78781213 CAGTTTCCTCATCTATGCAGGGG - Intergenic
1070819086 10:79344338-79344360 CAGTCCTCTCACCTGTACAGTGG + Intergenic
1070918090 10:80167675-80167697 ATGTGTGCTCACATGTGCTGTGG - Intronic
1071808782 10:89155193-89155215 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1071986727 10:91059125-91059147 CAGTTTCTTCACCTGTGAAGTGG + Intergenic
1072189352 10:93067523-93067545 CAGTGTTCTCATCTGTGAACTGG - Intronic
1072313528 10:94180021-94180043 CAGTTTTCTCACCTGTTAAGTGG - Intronic
1073051402 10:100669690-100669712 AAGTGTTCTCACAAGTGCAGGGG - Intergenic
1073461732 10:103669344-103669366 CAGTTTCCTCACCTGTGAAATGG + Intronic
1074120770 10:110493201-110493223 CAGAGTGCCCACAAGTGCAGGGG - Intergenic
1075346169 10:121683246-121683268 CAGTTTTCTCATCTGTGTAGTGG + Intergenic
1075535187 10:123265137-123265159 CACTTTTCTCACCTGTGAAGTGG + Intergenic
1075619062 10:123912368-123912390 CACTTTTCTCACCTGTTCAGTGG - Intronic
1075669554 10:124254983-124255005 CAGTCTCCTCATCTGTGCAGTGG + Intergenic
1075674173 10:124284358-124284380 CAGTTTGTTAACCTGTGCAATGG - Intergenic
1075689408 10:124385519-124385541 CAGTTTTCTCACCTGTGGAATGG + Intergenic
1075874333 10:125793970-125793992 CAGTGTCCTCACCTGTAATGAGG + Intronic
1075906345 10:126084903-126084925 CAGTGTGCTCACCTGTAAAATGG + Intronic
1076139441 10:128068021-128068043 CCGTGGGCTCCCCTGTGCTGGGG - Intronic
1076720954 10:132392894-132392916 CAGTGTCCTCATCTGTAAAGTGG - Intergenic
1076889565 10:133277017-133277039 GAGTTTCCTCACCTGTGCAAGGG - Intergenic
1077061399 11:619276-619298 CTGGGGGCTCACCTGTGGAGGGG + Intronic
1077193080 11:1263684-1263706 CAGTGTTCCCATCTGTGGAGTGG - Intergenic
1077693292 11:4369193-4369215 CAGTTTGCTCACTTATGAAGAGG + Intergenic
1077992375 11:7423485-7423507 CAGTGTTCTCATCTGTAAAGTGG + Intronic
1078186469 11:9055781-9055803 CAGTCTGCTCACCTCCACAGTGG + Exonic
1078655843 11:13238417-13238439 CAGTTTGCTCATTTGTGAAGTGG - Intergenic
1078896776 11:15603832-15603854 TGGTGTGCTCCCCTGTGTAGAGG + Intergenic
1079130621 11:17744915-17744937 CAGTGGCCTCAGCTGTGCTGAGG - Intronic
1080515361 11:33015279-33015301 CGGTGTCCTCACCTGTGATGCGG - Intergenic
1080617505 11:33957496-33957518 CAGTTTCCTCATCTGTGCAATGG + Intergenic
1080653531 11:34241183-34241205 CAGTTTCCTCATCTGTACAGCGG + Intronic
1080687000 11:34524286-34524308 CAGTGTGCCCACCTGCAGAGTGG - Intergenic
1081461601 11:43277506-43277528 CAGTGTTCTCATTTGTGAAGCGG + Intergenic
1081495659 11:43607612-43607634 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1081597530 11:44469353-44469375 CAGTTTTCTCATCTGTGAAGTGG - Intergenic
1081707012 11:45188298-45188320 CAGTTTTCTCAGCTGTGCAATGG - Intronic
1081962513 11:47148798-47148820 CAGTTTCCTCATCTGTGAAGAGG - Intronic
1083628299 11:64083060-64083082 CAGTTTCCTCACCTGTGAAATGG - Intronic
1083777826 11:64902833-64902855 CAGTTTGTTCATCTGTTCAGTGG - Intronic
1084006377 11:66325669-66325691 CAGGTTCCTCACCTGTGCAAGGG + Intergenic
1084033552 11:66494689-66494711 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1084193098 11:67507870-67507892 CAGTTTGCTGGCCTGTGAAGTGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084437782 11:69154421-69154443 CACGGAGCTCACCTGTGGAGAGG + Intergenic
1084469937 11:69353645-69353667 CAGTTTCCTCATCTGTGAAGGGG + Intronic
1085310407 11:75513361-75513383 CAGTTTGCTCATCTGTGAAAGGG - Intronic
1085540971 11:77269316-77269338 CAGAGGGCTCAACTGTACAGGGG + Intronic
1085734560 11:79028126-79028148 CAGTTTCCTCACTTGTGAAGTGG + Intronic
1086181822 11:83961205-83961227 CAGTTTTCTCACCTGTACAAGGG - Intronic
1087151742 11:94866271-94866293 CAGTTTACTCATCTGTGAAGTGG + Intronic
1088120723 11:106365678-106365700 CAGTTTACTCATCTGTGAAGGGG + Intergenic
1088606038 11:111533306-111533328 CAGTTTCCTCACCTATACAGTGG + Intronic
1088801847 11:113314108-113314130 CAGTTTTCTCACCTGTGAAATGG - Intergenic
1088832780 11:113551642-113551664 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1089323382 11:117641457-117641479 CAGTGTGCGCATCTGTTCGGTGG - Intronic
1089333827 11:117709016-117709038 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1090000422 11:122951789-122951811 AAGTGTGAACACCAGTGCAGAGG + Intronic
1090137965 11:124219322-124219344 TAGTCTGCTCTCCTGTGAAGTGG + Intergenic
1090278742 11:125438338-125438360 CAGTGTTCTTTCCTGTGCAAAGG - Intergenic
1090385277 11:126354904-126354926 CACTGTGCTGACCTGTGAAAGGG + Intergenic
1090407909 11:126488380-126488402 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1090732239 11:129581782-129581804 CAGTCTCCTCACCTCTGCAGTGG - Intergenic
1090880830 11:130830358-130830380 CACTGAGCTCGCCTGTGCACCGG + Intergenic
1090885249 11:130870393-130870415 CAGGGTGCACACCTGAACAGGGG + Intergenic
1090954940 11:131505527-131505549 CAGTGTCCTCACCTGTGAAAAGG - Intronic
1091322844 11:134664121-134664143 CAGTGTGCTCATCTGTAAAATGG + Intergenic
1091569632 12:1673279-1673301 CACTGTGCCCAGCTGTGAAGTGG + Intergenic
1091620938 12:2088474-2088496 CAGTGTTCTCATCTGTGAAGTGG + Intronic
1092153819 12:6269220-6269242 CAGTTTCTTCACCTGTGAAGTGG + Intergenic
1092206812 12:6619865-6619887 CAGAGAGCCCACCCGTGCAGAGG - Exonic
1092790924 12:12070335-12070357 CAGTTTCCTCATCTGTGCAATGG + Intronic
1094089178 12:26629223-26629245 CACTGTGAGCACCTGTGCGGAGG - Intronic
1095289116 12:40455613-40455635 AAGTGTTCTCATCTGTGAAGTGG + Intronic
1095685277 12:45026111-45026133 CAGTGTGGTTACCTTTGAAGAGG - Intronic
1099442043 12:82710793-82710815 CAGTTTGCACATCTGTGAAGAGG + Intronic
1100779325 12:98007509-98007531 CTGTGTTCTCACTTGTGGAGGGG - Intergenic
1100800599 12:98226557-98226579 CAGTTTTCTCACCTGTACAATGG - Intergenic
1101363111 12:104046370-104046392 CAGTTTTCTCACCTGTGTATTGG - Intronic
1101750211 12:107577275-107577297 CAGTGTCTTCACCTGTAAAGTGG - Intronic
1101996738 12:109530883-109530905 AGGTATGCCCACCTGTGCAGGGG - Intronic
1102080892 12:110097298-110097320 CAGTTTGCTCACCTGTAAAATGG + Intergenic
1102169506 12:110831391-110831413 CAGTTTCCTCACCTGTAAAGGGG + Intergenic
1102200203 12:111052863-111052885 CAGTGAGATCAACTCTGCAGTGG - Intronic
1102366988 12:112346104-112346126 CAGTTTTCTCACCTGTGAAATGG - Intronic
1102399081 12:112613127-112613149 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1102497398 12:113329208-113329230 CAGTTTTCTCATCTGTGAAGTGG - Intronic
1102517366 12:113458778-113458800 CAGTGTGCTCACCTGTGAAATGG - Intergenic
1102772831 12:115493456-115493478 CAGTTTGCCCACCTGTGGAATGG + Intergenic
1102918688 12:116775397-116775419 CAGTGTCCTCACCTGTGAAATGG - Intronic
1103197281 12:119055783-119055805 CAGTTTCCTCACCTGTGAAATGG + Intronic
1103530675 12:121599316-121599338 CAATGTCCTCAGCTGTGGAGCGG - Intergenic
1104414890 12:128589822-128589844 CAGTTTTCTCACCTGTAAAGTGG + Intronic
1104430845 12:128714766-128714788 CACTTTGCTTACCTCTGCAGAGG - Intergenic
1104682695 12:130762301-130762323 CTGTGTATTCACCTGTGCTGGGG - Intergenic
1104860944 12:131923241-131923263 CATTGTGGGCACCTGTGGAGGGG - Intergenic
1104944323 12:132408929-132408951 CAGTTTCCTCACCTGTGACGTGG + Intergenic
1104954689 12:132458460-132458482 CAGTCTCCTCACCTGTAAAGGGG - Intergenic
1106032934 13:26018809-26018831 CAGTTTTCTCATCTGTGAAGTGG + Intronic
1106580765 13:31016565-31016587 CAGTGTGCTCACGTGGTGAGGGG + Intergenic
1106700626 13:32224375-32224397 CATGCTGCTCACCTGTGGAGTGG - Exonic
1107431779 13:40346738-40346760 CAGTGTCCTCATCTGTACAATGG - Intergenic
1107708897 13:43133298-43133320 CACAGTGCTGACCTTTGCAGGGG - Intergenic
1110040769 13:70755069-70755091 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1110281259 13:73696718-73696740 CAGTTTTCTCATCTGTGAAGTGG - Intronic
1111962344 13:94825456-94825478 CAGTTTCCTCACCTGTAAAGGGG - Intergenic
1113459032 13:110468863-110468885 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1115954512 14:38763346-38763368 CAGTATCTTCACCTGTGAAGTGG + Intergenic
1116326807 14:43540791-43540813 CCCTGTGCTCCCCTGCGCAGTGG + Intergenic
1117665009 14:58047516-58047538 CAGTTCTCTCATCTGTGCAGTGG - Intronic
1117905028 14:60575868-60575890 CAGTGTTCTCATGTGTACAGTGG + Intergenic
1118349051 14:64960551-64960573 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1118448739 14:65877317-65877339 CAGGGTGCTCACAGGTGCTGGGG + Intergenic
1118679630 14:68226729-68226751 CAGTTTGCTCACCTGTAAAATGG - Intronic
1118810793 14:69271556-69271578 GACTGTGCTCACCAGTGCAGTGG + Intronic
1119093190 14:71803647-71803669 CAGTGTTCTCAGCTGGTCAGTGG + Intergenic
1119756178 14:77121346-77121368 CAATGTACTCACTTGTGCAAGGG - Intronic
1119779173 14:77266722-77266744 CAGTTTTCTCACCTGTGGAATGG - Intronic
1119881850 14:78105947-78105969 CGGTGTTCACACCTGTGCATTGG + Intergenic
1120177429 14:81309858-81309880 AAGAGTGGTCATCTGTGCAGAGG - Intronic
1120979732 14:90279231-90279253 CAGTGAGCCCACCTGTGCAGAGG + Intronic
1121156448 14:91689386-91689408 CAGTGAGCCCAGCTGTCCAGTGG + Intronic
1121235568 14:92389334-92389356 CAGTTTACTCACCTGTGAAATGG - Intronic
1121312600 14:92943334-92943356 CAGGGTCCTCACCTGTGAAACGG - Intronic
1121379832 14:93454452-93454474 TAGTGTGCTAAAATGTGCAGTGG + Intronic
1121510616 14:94510147-94510169 CAGTGTACTCACCTGTACAATGG + Intronic
1121995388 14:98598607-98598629 CAGTTTCCTCATCTGTTCAGTGG - Intergenic
1122016297 14:98799627-98799649 CAGTGTCCTCATCTGTGCAATGG - Intergenic
1122059492 14:99127102-99127124 CAGTGAGCTCTCCTGTGGGGTGG - Intergenic
1122079698 14:99258010-99258032 CAGTGTGCCCATCTGTCCTGTGG - Intronic
1122087373 14:99317095-99317117 CAGTTTCCTCACCTGTGAAATGG + Intergenic
1122268957 14:100559796-100559818 CTGTGTGCGCATCTATGCAGAGG - Intronic
1122271963 14:100572351-100572373 GAGTGAGCCCACCTCTGCAGGGG + Intronic
1122325491 14:100878950-100878972 CAGAGCTCTCACCTGTGGAGGGG + Intergenic
1122393418 14:101406464-101406486 CTGTGTTCTCACCTGTGAAAGGG - Intergenic
1122411665 14:101528874-101528896 CAGTCTCCCCATCTGTGCAGTGG - Intergenic
1122487541 14:102091207-102091229 CAGTGTTCTCAACTGTACAGTGG - Intronic
1122692504 14:103537921-103537943 CAGTTTCCCTACCTGTGCAGTGG - Intergenic
1123059333 14:105587382-105587404 CAGGGTGCCCACCAGAGCAGAGG - Intergenic
1123083665 14:105707613-105707635 CAGGGTGCCCACCAGAGCAGAGG - Intergenic
1123677328 15:22723535-22723557 CAGTGTGGTCAGCTGTACTGGGG - Intergenic
1123805770 15:23871035-23871057 TAGTGTCCTCACTTGTGCAGTGG - Intergenic
1124379176 15:29150139-29150161 CAGTTTCCTCACCTGTGAAGTGG - Intronic
1124694492 15:31852675-31852697 CAATGGGCTCATCTGTGAAGTGG + Intronic
1125250372 15:37695208-37695230 CAGTGCTCTCTCCTCTGCAGAGG + Intergenic
1125602857 15:40925149-40925171 CAGTTTTCTCATCTGTGCAATGG - Intergenic
1126385665 15:48090824-48090846 CAGTCTTCTCACCTGTCAAGTGG + Intergenic
1126944843 15:53808185-53808207 CAGTTTACTCACCTGTGAAATGG + Intergenic
1126960450 15:53987998-53988020 ATGTGTGGTTACCTGTGCAGAGG + Intergenic
1127912702 15:63431231-63431253 CAGTGTGCTTACCTCTGAAATGG + Intergenic
1127961247 15:63892534-63892556 CAGTTTCCTCACCTGTGAATCGG - Intergenic
1127978466 15:64016438-64016460 CAGTGTTCTCATCTGTAAAGTGG + Intronic
1128156523 15:65395101-65395123 CAGTGTGTGCACCAGTGCTGGGG + Exonic
1128334752 15:66778798-66778820 CAGTTTCCTCACCTGTGGAATGG + Intronic
1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG + Intronic
1128512921 15:68324859-68324881 CCCTGTGCTCCCCTGTGCTGGGG + Intronic
1128545841 15:68567027-68567049 CAGTTTTCTCATCTGTGAAGTGG + Intergenic
1128679135 15:69635024-69635046 CAGTCTCCTCACCTGTGAAATGG + Intergenic
1128703066 15:69818235-69818257 CAGTTTTCTCACCTGTAGAGTGG + Intergenic
1128761120 15:70216616-70216638 CAGTTTCCTCGCCTGTGAAGTGG + Intergenic
1129059928 15:72852730-72852752 CAGTGTCCTTATCTGTGAAGTGG - Intergenic
1129107842 15:73321555-73321577 CAGTTTGCCCATCTGTACAGTGG - Exonic
1129693054 15:77724595-77724617 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1129708344 15:77807286-77807308 CAGTGAGCTCTCCTGGGCAGGGG + Intronic
1129739661 15:77984154-77984176 CAGTGTCCTCCTCTGTGAAGTGG - Intronic
1129873638 15:78957870-78957892 CAGTTTTCCCACCTGTGCAATGG - Intergenic
1130174462 15:81553937-81553959 CAGTCTGGTCATCTATGCAGTGG - Intergenic
1130993981 15:88894182-88894204 CAGTTTCCTCAACTGTGAAGAGG - Intronic
1132028883 15:98424583-98424605 CAGTCTCCTCACCTGTGAAAAGG - Intergenic
1132071258 15:98778431-98778453 CAGTCTTCTCATCTGTGAAGTGG - Intronic
1132196373 15:99917319-99917341 CAGTTTCCCCGCCTGTGCAGCGG + Intergenic
1132396403 15:101478218-101478240 CAGTTTGCTCATCTGTGTAATGG + Intronic
1132584171 16:699102-699124 CAGTTTCCTCATCTGTGCAGTGG - Intronic
1132873942 16:2127722-2127744 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1132976690 16:2714594-2714616 CAGCTTTCTCACCTGTGCTGTGG + Intronic
1133716300 16:8452641-8452663 CAGTTTCGTCATCTGTGCAGTGG - Intergenic
1134036756 16:11037055-11037077 CAGTTTCCTCACCTGTGAAGTGG - Intronic
1134178448 16:12028002-12028024 CAGTTTCCTCATCTGTACAGTGG - Intronic
1134553029 16:15146896-15146918 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1134684125 16:16146879-16146901 CAGTTTCCTCACCTGTGAAATGG + Intergenic
1134693751 16:16208016-16208038 CAGTTTTCTCATCTGTTCAGTGG - Intronic
1134864878 16:17597072-17597094 CAGTGTCCTCATCTGTCAAGTGG - Intergenic
1134978092 16:18586627-18586649 CAGTTTTCTCATCTGTTCAGTGG + Intergenic
1135104215 16:19633345-19633367 CAGTTTTCTCACCTGTGAAATGG + Intronic
1135155511 16:20049467-20049489 CAGTTTTCTCATCTGTGCAATGG + Intronic
1135348094 16:21706329-21706351 AGGTGTGCTCACCAGAGCAGCGG - Intronic
1135480896 16:22819260-22819282 CAGTCTGCTCACCTGTGAAATGG + Intronic
1135548802 16:23382894-23382916 CAGTGTTCTTACCTGTGCAATGG - Intergenic
1135731431 16:24898099-24898121 CTGTGTTCTCACCTGGGAAGAGG - Exonic
1136928259 16:34395349-34395371 CAGTCTTCTCACCTGTGAAGTGG - Intergenic
1136976315 16:35016455-35016477 CAGTCTTCTCACCTGTGAAGTGG + Intergenic
1137264644 16:46858903-46858925 CAGTTTCCTCACCTGTACAATGG - Intergenic
1137556617 16:49474294-49474316 CAATTTCCTCACCTGTGCAGTGG - Intergenic
1137674680 16:50298461-50298483 CAGTGTGCCCAGCTGTGATGGGG - Intronic
1138181098 16:54940467-54940489 CAGTGTCCTCATCTGTGAAATGG + Intergenic
1138216384 16:55208403-55208425 CAGTTTACTCACCTGTGTACTGG - Intergenic
1138237903 16:55401037-55401059 CAGTTTCCTCACTTGTCCAGTGG - Intronic
1138249760 16:55492877-55492899 CAGTTTCCTCACCTGTGAAATGG + Intronic
1139281720 16:65776320-65776342 CAGTTTGCTCACCTGTAAAATGG - Intergenic
1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG + Intronic
1139444490 16:66988500-66988522 CCGTTTGCTCATCTGTGCAGTGG - Intergenic
1139513980 16:67442693-67442715 CAGTGTGCTCACTTATGGTGGGG - Intronic
1140211133 16:72971433-72971455 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1141180934 16:81752941-81752963 CAGTTTCCTCATCTGTGTAGTGG + Intronic
1141195141 16:81854775-81854797 CAGTTTGCTCAGCTGTGAAATGG + Intronic
1141358477 16:83372190-83372212 CAGTGTTCTCACCTATAAAGTGG - Intronic
1141553483 16:84821468-84821490 CAGTTTCCTCAGCTGTGAAGTGG - Intronic
1141749504 16:85948663-85948685 CAGTTTCCTCACCTGTACAGTGG + Intergenic
1142000379 16:87660894-87660916 CAGTTTTCTCATCTGTCCAGTGG + Intronic
1142003436 16:87677551-87677573 CAGTTTCCTCACCTGTGCAGGGG - Intronic
1142122015 16:88391158-88391180 CAGTTTCCCCACCTGTTCAGTGG + Intergenic
1142201033 16:88761269-88761291 CTGTGTGCTCATCTGTGAAATGG - Intronic
1142233188 16:88909360-88909382 CAGTGTCCACATCTGTGCAATGG + Intronic
1142324841 16:89408081-89408103 CAGTGGTCACACATGTGCAGTGG - Intronic
1142414021 16:89931670-89931692 CAGTGTCCTCATCTGTACAATGG - Intronic
1142503311 17:346118-346140 CAGTTTGCTCACCTGTACAATGG - Intronic
1143262412 17:5609453-5609475 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1143624376 17:8100952-8100974 CAGTTTTCTCCCCTGTGAAGTGG + Intronic
1143659153 17:8314066-8314088 CAGTGTCCTCATCTGTGAAATGG + Intronic
1144477112 17:15597876-15597898 CAGTTTCCTCATCTGTGTAGTGG - Intronic
1144807433 17:17977301-17977323 CAGTGTGGACACCAGTCCAGTGG + Intronic
1144848349 17:18231563-18231585 CTGTGTGCTCATCTGTGAAATGG + Intronic
1145267282 17:21385892-21385914 CAGTGTCCTCCCCTGTGAAATGG + Intronic
1145267541 17:21387582-21387604 CAGTTTCCTCACCTGGGAAGTGG + Intronic
1146497680 17:33337515-33337537 CAGTTTGCTCAACTGTTCAAAGG + Intronic
1146926980 17:36751992-36752014 CAGTGTTCTCACCTATACAATGG + Intergenic
1147605690 17:41772578-41772600 CAGTGTCCTCATCTGTAAAGCGG + Intronic
1147614456 17:41819979-41820001 CAGTGTCCTCACCTGTCAAGTGG + Intronic
1147747470 17:42703943-42703965 CAGTGTGCTAACAGGAGCAGAGG + Intronic
1147976495 17:44250956-44250978 CATTTTGCTCACCTGTAAAGGGG - Intronic
1148323313 17:46770235-46770257 CAGTTTGCTCATCGGTGAAGTGG - Intronic
1148725303 17:49785181-49785203 CAGTTTTCTCACCTGTGATGTGG - Intronic
1148736880 17:49869954-49869976 CAGTGTCCTCATCTGTACAAAGG - Intergenic
1148847381 17:50537449-50537471 CAGTTTCCTCATCTGTACAGTGG + Intronic
1149143730 17:53464830-53464852 CAGTTTGCTAAGCTGTGCATTGG + Intergenic
1149194148 17:54099710-54099732 CAGTATTCTCACCTGTGAAATGG - Intergenic
1149496011 17:57117986-57118008 CAGTGTTCTCTCCTGTAAAGTGG + Intronic
1149561313 17:57609702-57609724 CAGTGAGCTTACCTTTGCAAGGG + Intronic
1149576202 17:57715383-57715405 CAGTTTCCTCACCTGTGCAATGG - Intergenic
1149581725 17:57755296-57755318 CAGTGTGCTCAGTTGTAAAGAGG - Intergenic
1150132499 17:62676736-62676758 CAGTTTTCTCATCTGTCCAGTGG + Intronic
1150630078 17:66874158-66874180 CAGTTTGCTCACCTGTAAAATGG + Intronic
1151337784 17:73450251-73450273 CAGTTTCCTCCTCTGTGCAGGGG + Intronic
1151349736 17:73524691-73524713 CAGTGTTCTCATCTATGCAATGG - Intronic
1151400882 17:73855280-73855302 CAGTGTCCTCCCCTGTACATTGG - Intergenic
1151930641 17:77229652-77229674 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1152236210 17:79140202-79140224 CAGTTTCCTCACCTGTACAATGG - Intronic
1152465695 17:80464834-80464856 CAGGGTCCTGACCTGTGCTGTGG - Intergenic
1152700991 17:81819759-81819781 CAGTGAGGTCAGCTCTGCAGGGG - Intergenic
1152733732 17:81986651-81986673 CAGTTTCCTCACCTGTGCCCCGG + Intronic
1152892809 17:82892036-82892058 CAACTTCCTCACCTGTGCAGGGG - Intronic
1153273637 18:3347616-3347638 CAGTGACCTCAACTGTGAAGTGG - Intergenic
1153337306 18:3937918-3937940 CAGTTTCCTCAGCTGTACAGTGG + Intronic
1154486692 18:14877624-14877646 CAGTTTTCTCATCTGTTCAGTGG - Intergenic
1154502379 18:15003275-15003297 CTGTGGGCTCACCTGAGCGGGGG + Intergenic
1157204216 18:45684958-45684980 AAATGTGCTCACTTGTGCAGTGG - Intergenic
1157421577 18:47551709-47551731 CAGTTCTCTCACCTGTGAAGTGG + Intergenic
1157528236 18:48401422-48401444 CAGTTTCCTCACCTATGCAGTGG - Intronic
1157803131 18:50637044-50637066 CAGTGTTCTCACCAGTGCTTTGG - Intronic
1158251300 18:55490421-55490443 CAGTTTGCTCATCTGTGAAATGG + Intronic
1159470834 18:68853959-68853981 CTGTGAACCCACCTGTGCAGAGG + Intronic
1160144423 18:76351940-76351962 CAGTTTCCACAGCTGTGCAGTGG - Intergenic
1160318164 18:77867149-77867171 CTGTGTGCTCACCTGTCCCGAGG + Intergenic
1160416165 18:78712663-78712685 CTGTATGTTCACCTTTGCAGGGG - Intergenic
1160919099 19:1511669-1511691 CAGTTTCCCCATCTGTGCAGTGG + Intronic
1160965185 19:1744323-1744345 CAGTTTGCTCACCTGTGAAGTGG + Intergenic
1161041695 19:2113872-2113894 CCGTGTCCTCACCTGTGTTGGGG - Intronic
1161435017 19:4258063-4258085 GAGTGTTCTCACCTGTGAAATGG + Intronic
1161482489 19:4517944-4517966 CAGTTTCCCCATCTGTGCAGTGG - Intergenic
1161517034 19:4702329-4702351 CAGTTTCCTCCCCTGTGCAGTGG + Intronic
1161772810 19:6240483-6240505 CAGCGTCCTCACCTGTGAAGTGG + Intronic
1161895329 19:7075385-7075407 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1162085513 19:8246640-8246662 CTGTGTGCTGACATGTGTAGGGG + Intronic
1162121186 19:8470019-8470041 CAGTGTGCTCACCTGAGCAGTGG + Intronic
1162439286 19:10682694-10682716 CCATGTGCTCACCTCGGCAGTGG - Exonic
1162445417 19:10719487-10719509 CGGTGTGCCCATCTGTCCAGTGG + Intronic
1162477321 19:10908312-10908334 CAGTTTCCTCATCTGTGAAGCGG + Intronic
1162545344 19:11325733-11325755 CAGTTTGCTCACCTGTAAAATGG + Intronic
1162829653 19:13276355-13276377 CAGTGTGATCACCTGCTCACAGG + Intronic
1163013090 19:14437557-14437579 CAGTTTCCTCACCTGTGAAGTGG + Intronic
1163242265 19:16071542-16071564 CAGTGTCCTCATCTGTGAAATGG + Intronic
1163272356 19:16261957-16261979 CAGTGTCCTCACCTGTCAAACGG + Intergenic
1163443628 19:17334157-17334179 CAGTTTCCTCACCTGTGAAATGG - Intronic
1163820188 19:19492087-19492109 CAGGGTGCCCACCTGGGCACTGG + Intronic
1164402613 19:27911995-27912017 CAGTTTCCTCACCTGACCAGGGG + Intergenic
1164985796 19:32647534-32647556 CAGTGTCCTCACTGGGGCAGGGG + Intronic
1165310503 19:35026731-35026753 CAGTGAGCTTTCCTGTGCAATGG + Intergenic
1166001324 19:39879239-39879261 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1166004107 19:39895490-39895512 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1166200682 19:41235754-41235776 CAGTGTTGTCATCTGTACAGTGG + Intronic
1166215896 19:41334833-41334855 CAGTTTCCTCATCTGTTCAGAGG + Intronic
1166750347 19:45161544-45161566 CAGTGTCCTCATCTGTGAAGCGG - Intronic
1167207468 19:48112297-48112319 CAGTGTCCTCACCTGTTAAATGG + Intergenic
1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG + Intronic
1167978428 19:53252343-53252365 CAGTGTGCCCACCTGTAACGTGG - Intronic
1168103923 19:54155453-54155475 CAGGGCCCTCACCTGGGCAGGGG - Exonic
1168245705 19:55112315-55112337 CAGTTTCCTCACCTGTGAAATGG - Intronic
1168294463 19:55372097-55372119 CAGTTTCCTCATCTGTGAAGGGG + Intergenic
1168297957 19:55386883-55386905 CCGTGTCCTCACCTGTAAAGTGG + Intronic
1202677600 1_KI270711v1_random:21870-21892 CTGTTTCCTCACCTGTTCAGAGG - Intergenic
1202678389 1_KI270711v1_random:28213-28235 CAGTTTCCTCATCTGTTCAGAGG - Intergenic
925711415 2:6744635-6744657 CAGTCTCCTCACCTGTGTAATGG + Intergenic
925992726 2:9266599-9266621 CAGAGTTCACACCTCTGCAGAGG - Intronic
926133375 2:10319530-10319552 CTGTGTGATCACCTTTTCAGGGG + Intronic
927857664 2:26537494-26537516 CACGGGCCTCACCTGTGCAGAGG + Intronic
927872181 2:26630689-26630711 CAGTCTGCTCCTCTTTGCAGTGG + Intronic
927919396 2:26960555-26960577 GAGAGTGCTCACCCATGCAGAGG + Intergenic
928211216 2:29325228-29325250 CAGTGTGAACACCTGCTCAGAGG + Intronic
928331349 2:30360255-30360277 CAGTCTTCTCACCTGTAAAGCGG + Intergenic
928385350 2:30862885-30862907 CAATGTGCCCACCTGTGAAGTGG - Intergenic
928399104 2:30965272-30965294 CAGTTTCCTCAGCTGTGAAGTGG + Intronic
928447751 2:31348083-31348105 CAGTTTCCTCATCTGTGCAAAGG - Intronic
929446295 2:42003957-42003979 CTGTGTGCTCACATGGGAAGGGG + Intergenic
929783874 2:44975344-44975366 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
929877936 2:45812543-45812565 CAGTGACCTCCTCTGTGCAGTGG + Intronic
930265431 2:49194134-49194156 CAGTGGGCTCTTCTGTGGAGGGG - Intergenic
931166494 2:59754703-59754725 CAGTGTTCTCTCCTGGGCTGGGG - Intergenic
932714672 2:74092717-74092739 CAGTGTCCCCAGCTGTGAAGTGG + Intronic
933248964 2:80007161-80007183 CAGTTTGCTTCTCTGTGCAGTGG + Intronic
934579705 2:95428192-95428214 CAGTGACCTCACCTGTGGAATGG - Intergenic
934599741 2:95648533-95648555 CAGTGACCTCACCTGTGGAATGG + Intergenic
934735742 2:96689052-96689074 CAGTGCCCTCACCTGTGCAATGG + Intergenic
935418835 2:102845744-102845766 CAGTTTTTTCACCTGTACAGTGG + Intergenic
936386070 2:112030483-112030505 CAGTCTGCCCATCTGTGAAGTGG - Intergenic
936533081 2:113290537-113290559 CAGTGACCTCACCTGTGGAATGG + Intergenic
937274343 2:120674448-120674470 CAGGGTTCTCATCTGTGCAGTGG - Intergenic
937276261 2:120686001-120686023 CAGTTTCCTCACCTGTGAACCGG - Intergenic
938240951 2:129741893-129741915 CAGTGTGCTCAGCTCTGCTCAGG + Intergenic
938379997 2:130831338-130831360 CAGTGTTCTCATTTGTGAAGGGG - Intergenic
938501554 2:131833447-131833469 CTGTGGGCTCACCTGAGCGGGGG + Intergenic
938904598 2:135826041-135826063 CAGTGTGCTCTCCAGCTCAGGGG + Intronic
939993858 2:148901912-148901934 CAGTGTTCTGGCCTCTGCAGGGG - Intronic
940238231 2:151534009-151534031 CTGTGTTCTCACTTGTGCTGTGG - Intronic
941181790 2:162268142-162268164 CAGTGTGCTAGCCTGTTCTGGGG - Exonic
945392153 2:209277519-209277541 CAGGGTCCACACCTGTGGAGGGG + Intergenic
945881181 2:215326934-215326956 CAGTGTGTACAGCTGGGCAGGGG - Exonic
946166661 2:217868665-217868687 CAGTGTTCTCACCTGTAAAGTGG - Intronic
946821562 2:223634869-223634891 CAGTTTTCTCAACTGTACAGTGG - Intergenic
947132535 2:226943922-226943944 CTGTAGGCCCACCTGTGCAGTGG + Intronic
947701790 2:232240542-232240564 CTGTGTCCTCATCTGAGCAGGGG + Intronic
948296899 2:236867438-236867460 CAGTGTGCGCATCTGTGAAATGG - Intergenic
948466640 2:238155334-238155356 CAGTTTCCTCATCTGTGCAATGG + Intergenic
948547364 2:238742425-238742447 CAGTGTTCTCATCTGTTAAGTGG - Intergenic
948834187 2:240616864-240616886 CTGTGTGCTGCCCTGTGAAGAGG + Intronic
1168904470 20:1392534-1392556 CAGTTTCCTCATCTGTGCAGCGG + Intronic
1169265787 20:4166699-4166721 CAGAGTGCTCACCTCTCCCGGGG + Intronic
1169331051 20:4716867-4716889 GAGTTTTCTCATCTGTGCAGGGG - Intergenic
1169746483 20:8948169-8948191 CAATTTCCTCACCTGTACAGTGG - Intronic
1170746777 20:19106608-19106630 CAGTTTCCTCACCTGTGCAATGG - Intergenic
1172020354 20:31909546-31909568 CAGTTTCCTCATCTGTGAAGTGG + Intronic
1172048960 20:32101640-32101662 CAGTTTCCTCATCTGTCCAGTGG + Exonic
1172099609 20:32477263-32477285 CAGTTTCCTCATCTGTGGAGCGG - Intronic
1172126792 20:32629235-32629257 CAGTTTCCTCACCTCTGCAATGG - Intergenic
1172229114 20:33325067-33325089 CAGTTTGCTCACCTGTAGAAGGG - Intergenic
1172453008 20:35041816-35041838 CAGTTTCCTCACATGTGCAATGG + Intronic
1172657475 20:36545982-36546004 CAGTTTCCCCATCTGTGCAGTGG - Intronic
1172772578 20:37390050-37390072 CAGTTTGCCCACCTGTGAAATGG - Intronic
1172775588 20:37404817-37404839 CAGTGTGCCCATCTGTAAAGGGG + Exonic
1172816878 20:37694180-37694202 CCGCGTTCTCACCTGGGCAGGGG + Intronic
1172874644 20:38156783-38156805 CAGTTTTCTCACCTGGGCAAGGG - Intronic
1172883984 20:38219294-38219316 CAGTTTCCTCATCTGTGCAGTGG + Intronic
1173328332 20:42053558-42053580 CACTGGGCTTAACTGTGCAGTGG - Intergenic
1173849015 20:46206138-46206160 CAGCGTCCTCCCCTGTGCACTGG - Intronic
1173941425 20:46914360-46914382 CAGTTTTCTCATCTGTGGAGTGG + Intronic
1173945146 20:46944384-46944406 CGGTCTCCTCACCTGGGCAGTGG + Intronic
1173956981 20:47040969-47040991 CTGTGTGCTCACAGCTGCAGGGG + Intronic
1174367680 20:50066365-50066387 CAGTGTCCTCATCTGTGAAATGG + Intergenic
1174407230 20:50310286-50310308 CAGTGTGCCCACCTGTGAGATGG + Intergenic
1175150866 20:56932875-56932897 CTGTTTCCTCACCTGTGCAATGG - Intergenic
1175206316 20:57314460-57314482 CAGTTTTCTCATCTGTGAAGTGG - Intergenic
1175270628 20:57731427-57731449 CAGTTTCCTCACCTGTACAATGG + Intergenic
1175326298 20:58130766-58130788 CAGTATGCTCAGCTGTCTAGTGG - Intergenic
1175859310 20:62141946-62141968 CACTGTGAGCACCTGGGCAGGGG + Intronic
1175913303 20:62414643-62414665 CAGTTTCCTCGCCTGTGGAGTGG - Intronic
1176047030 20:63097967-63097989 CAGTTTCCCCATCTGTGCAGTGG + Intergenic
1176794610 21:13361775-13361797 CAGTTTTCTCATCTGTTCAGTGG + Intergenic
1178405146 21:32317423-32317445 CATGGTGCTCACCTGTAAAGAGG - Intronic
1178839450 21:36127183-36127205 CAGTTTGCTCATCTGTACAATGG - Intergenic
1179166260 21:38937504-38937526 CAGTGCACTCATCTGTACAGTGG - Intergenic
1179262968 21:39774919-39774941 CAGTTTTCTCACCTGTAAAGTGG + Intronic
1179292341 21:40029637-40029659 AATAGTGCTGACCTGTGCAGAGG - Intronic
1179372095 21:40815827-40815849 CAGTTTGCTCATCTGTAAAGGGG + Intronic
1179503885 21:41827080-41827102 CAGTTTTCTCACCTATGCAGGGG - Intronic
1179932602 21:44580137-44580159 CTGTGTGCCCACCTGTTCTGAGG - Exonic
1180066834 21:45416515-45416537 CAGTGTGCTCTCCTGGGCCTCGG + Intronic
1180066846 21:45416589-45416611 CAGTGTGCTCTCCTGGACCGCGG + Intronic
1180927475 22:19566329-19566351 CAGTTTCCTCAGCTGTGCAAAGG - Intergenic
1181133084 22:20745746-20745768 CAATGTGCTCATCTGTAAAGTGG + Intronic
1181518982 22:23434549-23434571 CAGTGTCCCCACCTGTGAAATGG - Intergenic
1181760127 22:25052504-25052526 CAGTTTGCCCATCTGTGAAGTGG - Intronic
1181882491 22:25992112-25992134 GAGCTTGCTCACCTGTGCAGGGG - Intronic
1181895214 22:26101197-26101219 CAGTGTCTGCACCTGTGCAATGG - Intergenic
1182432246 22:30306244-30306266 CAGTTTCTTCATCTGTGCAGTGG - Intronic
1182557058 22:31134873-31134895 CAGTTCGCTCACCTGTGAAATGG - Exonic
1183035573 22:35138660-35138682 CAGTTTGCTCACCTGTGAAATGG + Intergenic
1183157418 22:36086033-36086055 CAGTTTCCTCACCTGTCAAGTGG - Intergenic
1183250545 22:36727104-36727126 CAGTTTGCTCACCTGTCAAATGG - Intergenic
1183326524 22:37197555-37197577 CAGCCTCCTCACCTGTGAAGTGG - Intronic
1183383997 22:37504531-37504553 CAGTGTCCTCACCTGTGAAATGG + Intronic
1183453363 22:37908171-37908193 CAGTGTCCTCATCTGTGAGGTGG + Intronic
1183811951 22:40265225-40265247 TACTGTGCTAACCTGTGCACTGG - Exonic
1183931046 22:41236472-41236494 GGGGGTGCCCACCTGTGCAGCGG + Exonic
1183933497 22:41249110-41249132 CACTGTCCTCAGCTGGGCAGAGG + Intronic
1184089931 22:42287343-42287365 CAGTTTGCTCATCTGTGAAATGG - Intronic
1184102155 22:42346562-42346584 CAGTCTCCTCAGCTGTGAAGTGG + Intergenic
1184177099 22:42794618-42794640 CAGTGTCCTCCTCTGTGAAGTGG + Intergenic
1184236601 22:43186570-43186592 CAGTGTTCTCATCTGTGAAGTGG + Intronic
1184452458 22:44591218-44591240 CAGTGTCCTCATCTGTGCTATGG - Intergenic
1184480680 22:44745107-44745129 CAGTGGGAGCATCTGTGCAGTGG - Intronic
1184480682 22:44745124-44745146 CAATGAGATCATCTGTGCAGTGG - Intronic
1184526085 22:45023776-45023798 CAGTTTCCTCACCTATACAGTGG - Intergenic
1184549260 22:45195797-45195819 CAGTTTGCCCACCTGTGAAATGG - Intronic
1184747077 22:46462250-46462272 CAGTGTGGTCACCTGCCCCGTGG - Intronic
1185041793 22:48507945-48507967 CAGTGTCCTCATCTGTGCAGTGG + Intronic
1185096658 22:48810330-48810352 CAGTGTGCTGAGCAGTGCAATGG - Intronic
1185186590 22:49404627-49404649 CAGTGTTCTCACCTGTAAGGTGG - Intergenic
1185223495 22:49640565-49640587 CAGTGTGCTCAGCAGTGGGGAGG - Intronic
950053434 3:10008593-10008615 CAGTTTCCTCACCTGGACAGTGG - Intronic
950138266 3:10598349-10598371 CAGTTTACTCACCTGTGAAGTGG + Intronic
950173924 3:10858628-10858650 CAGTGTGCCCACCTATAAAGTGG - Intronic
950305072 3:11910878-11910900 CAGTTTCCTCACCTGGACAGTGG - Intergenic
950305864 3:11915028-11915050 CAGTTTCCTCACCTTTACAGTGG - Intergenic
950437951 3:12992021-12992043 GCCTGTGCTCACCTCTGCAGGGG - Intronic
950472947 3:13197751-13197773 CAGTGTGCCCACCTGTGAACGGG - Intergenic
950575775 3:13831335-13831357 CAGTCTGCTCATCTGTGAAATGG - Intronic
950645887 3:14376542-14376564 CAGTTTCCTCATCTGTGAAGTGG + Intergenic
950718227 3:14864598-14864620 CAGTTTCCTCATCTGTGAAGTGG + Intronic
951063463 3:18237083-18237105 CAGTGTTCTCTGCTGTGCAATGG + Intronic
951308747 3:21098563-21098585 CTGTGTGCTCATCTGTGGAATGG - Intergenic
951484892 3:23200947-23200969 CAGTATTCTCATCTGTACAGTGG + Intergenic
952069947 3:29622797-29622819 CAGTGTGCTCATCTGTAAAATGG + Intronic
952277514 3:31891736-31891758 CAGTGTGGTCAACTGTACATAGG + Intronic
953902131 3:46849398-46849420 CACTGTGGTCACCTGTGTGGAGG - Intergenic
953906693 3:46872034-46872056 CAGTGTTCACACCTGCACAGTGG + Intronic
954434140 3:50487056-50487078 CAGAGTGCTCATCCGTGAAGTGG - Intronic
954458711 3:50613781-50613803 CAGTTTTCTCACCTGTAAAGAGG - Exonic
954642622 3:52110619-52110641 CTGTGGGCTCTCCTGTGGAGAGG + Intronic
954988205 3:54814328-54814350 CAGTGTGCTTGCCTGTAAAGTGG - Intronic
954995157 3:54874660-54874682 CAGTTTCCTCACCTGTACAATGG - Intronic
955053481 3:55435004-55435026 CAGTTTCCTCACCTGTGAAATGG + Intergenic
955523186 3:59794964-59794986 CAGTTTCCTCACCTGTAAAGTGG + Intronic
955876431 3:63494696-63494718 TAGTTTGCTCACCTGTCAAGTGG - Intronic
956019188 3:64915459-64915481 CAGTGTTCTCATCAGTGCAATGG + Intergenic
956517870 3:70069725-70069747 CAGTTTGCTCATCTGTGAAATGG - Intergenic
959342763 3:105151343-105151365 CAATTTGTTCACCTGTGCATTGG - Intergenic
960264620 3:115606182-115606204 GAGTGTGATCACCTTTGCATAGG + Intergenic
960942969 3:122946569-122946591 CTGTGTGCTCAGCTGTGCTAAGG + Intronic
961457441 3:127031219-127031241 CAGTGTGCCAACCGGAGCAGGGG - Intronic
961569317 3:127786713-127786735 CAGTTCGCTCACCCGTGAAGTGG + Intronic
961569900 3:127790178-127790200 CAGTTTCCTCATCTGTGAAGTGG + Intronic
961640685 3:128363123-128363145 CAGTCTCCTCAGCTGTACAGCGG - Intronic
961787936 3:129358751-129358773 CAGTTTTCTCACCTGTAAAGTGG - Intergenic
961817611 3:129559302-129559324 CAGTGTGCTTATCTGTGAAGTGG + Intronic
962058245 3:131897302-131897324 CAGTTTTCTCACCTGTAGAGTGG + Intronic
962444680 3:135453979-135454001 CAGTGTCCCCATCTGTGCAATGG - Intergenic
963041477 3:141073146-141073168 CAGTTTTCCCATCTGTGCAGTGG + Intronic
963720322 3:148854603-148854625 CAGAGTGCTGAGCTTTGCAGAGG - Intronic
963837631 3:150073112-150073134 CTGTGTGGTCACACGTGCAGTGG - Intergenic
963983279 3:151563902-151563924 CAGTTTCCTCACCTGTGAAATGG - Intergenic
965879934 3:173376666-173376688 CTGTTTCCTCAGCTGTGCAGTGG + Intergenic
966614665 3:181900433-181900455 CAGTGTCCTCATCTGTTAAGTGG + Intergenic
966704091 3:182891871-182891893 CAGTTTTCTCACCTGTGAAAAGG + Intronic
967279668 3:187809788-187809810 CAGTTTCCTCACCTGTGAAATGG - Intergenic
968188362 3:196649408-196649430 CAGAGTGCGCACAGGTGCAGTGG - Intronic
968447547 4:659730-659752 GTGTGTGCTCACATGTGCACAGG + Intronic
968728476 4:2259055-2259077 CTCTCTGCCCACCTGTGCAGCGG - Intronic
968812441 4:2806057-2806079 CAGTTTCCTCACTTGAGCAGTGG - Intronic
969040063 4:4289195-4289217 CAGTTTGCTCATCTGTTTAGTGG - Intronic
969116174 4:4872035-4872057 CAGTGTGCTCGTGTGTGCAATGG - Intergenic
969225361 4:5793778-5793800 CAGTGTCCTCATCTGTACAGTGG + Intronic
969243724 4:5918980-5919002 CAGTTTCCCCATCTGTGCAGAGG - Intronic
969252392 4:5976667-5976689 CAGTCTTCTCATCTGTGAAGGGG + Intronic
969257260 4:6010946-6010968 CAGTTTCCTCATCTGTGAAGTGG - Intergenic
969478479 4:7434472-7434494 CGCTGTGCACACCTGTGCCGGGG + Exonic
969532778 4:7739097-7739119 CAGCTTTCTCATCTGTGCAGTGG - Intronic
969564148 4:7967776-7967798 CAGTCTGCTCATCTGTGTAATGG + Intronic
969595759 4:8148520-8148542 CCGTTTGCTCACCTGTGAAGTGG + Intronic
969665909 4:8557599-8557621 CAGTTTTCTCATCTGTGAAGTGG + Intergenic
969710148 4:8838510-8838532 CAGTTTTCTCACCTGTGAAATGG + Intergenic
969893410 4:10280405-10280427 CAGAGTGCTCTCCTGTGATGTGG + Intergenic
970171356 4:13294014-13294036 CAGTTTCCTCATCTGTGAAGTGG + Intergenic
970927663 4:21471709-21471731 CAGTTTCCTCACCTGTGAAATGG - Intronic
971385743 4:26139208-26139230 CAGTTTCCTCATCTGGGCAGTGG + Intergenic
972241459 4:37197842-37197864 CAGTTTCCTTATCTGTGCAGTGG - Intergenic
972796546 4:42426545-42426567 CAGTTTCCTCAGCTGTACAGTGG + Intronic
973604050 4:52569534-52569556 CAGTGTGCTCATCTTTAAAGTGG - Intergenic
976474328 4:85465843-85465865 CAGTGTGCTCACCTTGGAAAAGG + Intergenic
979486554 4:121277280-121277302 CAGTGTCCTCACATGTGAAATGG + Intergenic
981770044 4:148298939-148298961 CAGGGGGCCCACCTGTGCAGTGG + Intronic
982328977 4:154160319-154160341 CAGTTTGTTCATCTGTACAGGGG - Intergenic
982601271 4:157453302-157453324 CAGTGTGCTCACGAGTGTACTGG + Intergenic
983527431 4:168773545-168773567 CACTTTTCTCACCTGTGAAGTGG - Intronic
985377532 4:189356460-189356482 CACTGTGCTCACCTGTTCTGGGG + Intergenic
986390229 5:7278657-7278679 CAGGTGGCTCACCTGTGAAGTGG + Intergenic
988434205 5:31154474-31154496 CAGAGTGCACACATGTGCATAGG + Intergenic
988908693 5:35817336-35817358 CTGTGTCCTCACCTGTAAAGGGG - Intergenic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
990228265 5:53681292-53681314 CAGTTTACTCACCTGTACAAGGG + Intronic
990556269 5:56939588-56939610 CAGTTTTCTCACCTGTGAAATGG - Intronic
991288724 5:65009986-65010008 CTGTTTCCTCACCTGTGGAGAGG - Intronic
991586329 5:68205808-68205830 CCCTGTGCTCCCCTGCGCAGTGG - Intergenic
991953882 5:71972886-71972908 CAGTGTCCTCATCTGTACAATGG - Intergenic
992417662 5:76567191-76567213 CAGTTTCCTCACCTGTGAAGTGG + Intronic
992672001 5:79070058-79070080 CAGTTTCCTCACCTGTGAAATGG - Intronic
992768466 5:80024980-80025002 CAGTTTTCTAATCTGTGCAGTGG + Intronic
992879752 5:81095976-81095998 CAGTTTTCTCACCTGTGAAATGG - Intronic
996749735 5:126876457-126876479 CAGTGTCCTCATCTGTCAAGTGG - Intronic
996771795 5:127094118-127094140 CAGTGTTCTCATCTGTGAAATGG - Intergenic
996802464 5:127419199-127419221 CAGTCTGCTCTCCTGTGGACGGG + Exonic
997605222 5:135170401-135170423 CAGCTTGCTCATCTGTGAAGTGG - Intronic
997614765 5:135238825-135238847 CAGTTTCCTCATCTGTGCAATGG + Intronic
997622597 5:135308427-135308449 CAGTGTGCTCATCTGTAAAACGG + Intronic
997628863 5:135351051-135351073 CAGTGTGCGCACATGTGGATGGG + Intronic
998229358 5:140350068-140350090 CAGTTTGCTCACCTGAAAAGTGG + Intergenic
998498449 5:142611369-142611391 CAGTTTCCTCACCTGTGGAATGG - Intronic
999186564 5:149715044-149715066 CAGTTTCCTCATCTGTACAGTGG + Intergenic
999210445 5:149883754-149883776 CAGTGTTCCCATCTGTACAGCGG + Intronic
999260140 5:150233234-150233256 CAGTTTGCTCATCTGTGACGTGG - Intronic
1001001995 5:168016188-168016210 CAGTGTCCTCATCTGTGAAATGG - Intronic
1001227458 5:169957491-169957513 CAGTTTTCTCATCTGTTCAGTGG - Intronic
1001489542 5:172145727-172145749 CAGTATGCTCATCTGTAAAGTGG + Intronic
1001491876 5:172161829-172161851 GAGTGTGCACACCTGGGCATGGG - Intronic
1001534178 5:172486970-172486992 CAGTTTTCTCACCTGTGAAATGG - Intergenic
1001571112 5:172731367-172731389 CAGTGTTCTCATCTGTCCAGTGG - Intergenic
1001702663 5:173718600-173718622 CAGTATCCTCACCTGTAAAGTGG - Intergenic
1001757101 5:174179041-174179063 CAGTTTCCTCATCTGTGCATTGG - Intronic
1001761415 5:174211121-174211143 CAGTTTTCTTACCTGTGAAGTGG + Intronic
1001861314 5:175058118-175058140 CAATGTTCATACCTGTGCAGTGG - Intergenic
1002778529 6:348991-349013 CAGTGTGCCCGGCTGGGCAGGGG + Exonic
1003094821 6:3133739-3133761 CTGTGTGCTCACACGGGCAGTGG - Intronic
1004324054 6:14657583-14657605 CAGAGTGCTCACCTTGTCAGTGG - Intergenic
1004468647 6:15908581-15908603 TGGTGTGCTCATCTGTGAAGTGG - Intergenic
1004560823 6:16748519-16748541 CAGTTTCCTCGCCTGTGCAATGG + Intronic
1005505429 6:26465198-26465220 CAGTGTGTCTCCCTGTGCAGTGG + Exonic
1005843681 6:29761382-29761404 CACTGGACTCACCTGTGGAGTGG + Intergenic
1006021338 6:31119540-31119562 CAGTGTCCTCATCTGTAGAGTGG + Intronic
1006429961 6:33989281-33989303 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1006902484 6:37512118-37512140 CAGTGTGCTCATCTGGAAAGCGG - Intergenic
1007399957 6:41597940-41597962 CTGTGTGCTCACCTGTACTGGGG - Exonic
1007662237 6:43494000-43494022 CACTCTGCTCAGCTGTTCAGAGG + Intronic
1007708799 6:43807911-43807933 CAGTTTCCTCACCTGTCTAGTGG - Intergenic
1007831556 6:44642830-44642852 CAGTGTTCTCACCTGTACGATGG - Intergenic
1009697158 6:67121552-67121574 CATTTTGCTCAGCTGTGAAGTGG + Intergenic
1009972491 6:70639545-70639567 CAGTGTGCTCACCAGTTGCGTGG - Intergenic
1012236382 6:96821036-96821058 CATTGTGCCCACCTTGGCAGTGG + Intronic
1012449157 6:99336729-99336751 CAGTGTCCTCATCTGTAGAGTGG + Intronic
1013297068 6:108767139-108767161 CAGTGTTCTCAATTGTGTAGTGG - Intergenic
1015052135 6:128854142-128854164 CAGTGTGCTTACCTATGCTTTGG + Intergenic
1016529188 6:145039198-145039220 CAGTGTGCTCATGCGAGCAGAGG + Intergenic
1017075720 6:150615983-150616005 CAGTTTCCTCATCTGTGAAGTGG - Intronic
1017960654 6:159217968-159217990 CGGTCAGCTCACCTGTGTAGGGG - Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018280034 6:162175593-162175615 CTGTGTGCTAACCTGTACATGGG - Intronic
1018828978 6:167427718-167427740 CAGTGTGCTGACATGGACAGTGG - Intergenic
1018885640 6:167933960-167933982 CAGAGTCCTGGCCTGTGCAGGGG - Intronic
1019341013 7:508965-508987 CATTTTCCTCACCTGTGCAATGG - Intronic
1019347411 7:537832-537854 CAGCGTCCTCAGCTGTGAAGTGG + Intergenic
1019513740 7:1430628-1430650 CAGTCTTCTCACCTGTCAAGGGG - Intronic
1019592304 7:1841777-1841799 CAGTGTCCCCACCTGTGAAATGG + Intronic
1019927234 7:4201305-4201327 CAATCTGCTCCCCTGAGCAGGGG - Intronic
1021790419 7:24199161-24199183 CGGTGTCCTCACCTGTGAATGGG + Intergenic
1021936428 7:25636542-25636564 CAGTGTCTTTATCTGTGCAGTGG - Intergenic
1022171560 7:27836752-27836774 CAGTGTGTGCTGCTGTGCAGTGG - Intronic
1022505522 7:30906920-30906942 CCCTGTGCTCAGCTCTGCAGCGG + Intergenic
1023045792 7:36209064-36209086 CAGTGTTCTCATCTATGAAGTGG + Intronic
1023578256 7:41653131-41653153 CAGTTTTCTCACCTGTTGAGTGG - Intergenic
1023860136 7:44213548-44213570 CAGTCTGCCCACCTGTGCTCAGG + Exonic
1024685557 7:51741190-51741212 GCATGTGATCACCTGTGCAGTGG - Intergenic
1027348827 7:77289571-77289593 CAGTTTGCTCATCTGTGTAATGG + Intronic
1031125187 7:117765418-117765440 CAGTCTGCTCACCTGTTAATAGG - Intronic
1032196833 7:129794298-129794320 CAGTTTCCCCACCTGTGAAGTGG - Intergenic
1032781547 7:135168558-135168580 CAGGGCACTCACCAGTGCAGAGG + Intronic
1032997444 7:137463806-137463828 CAGTTTTCTCATCTGTGAAGGGG - Intronic
1033170457 7:139079234-139079256 CAGAGTGCTGACTTGTGCAGGGG + Intronic
1033304118 7:140211863-140211885 CAGTTTTCTCACCTGTGAAATGG - Intergenic
1034548915 7:151808000-151808022 CCCTGTGCTCACTTGGGCAGAGG - Intronic
1035585437 8:769357-769379 CAGTGTGGTCAGTTGTGAAGTGG + Intergenic
1035896916 8:3413291-3413313 CAGGGAGCTCTACTGTGCAGAGG + Intronic
1036463346 8:8973844-8973866 CAGTGAGGACACCAGTGCAGTGG + Intergenic
1037591393 8:20315051-20315073 CAGTGTTCTCATCTGCGAAGTGG - Intergenic
1037751712 8:21686613-21686635 CAGTTTGCTCATCTGTGAAATGG - Intergenic
1037770877 8:21798825-21798847 CAGTATTCTCACCTGTGAAAAGG - Intronic
1037815837 8:22111424-22111446 CAGTTTTCCCACCTGTGAAGTGG + Intergenic
1039474506 8:37832706-37832728 CAGTATTCTCAGCTGTACAGTGG - Intronic
1039556628 8:38480923-38480945 CAGTTTTCTCACCTGTGAATTGG - Intergenic
1039800328 8:40949044-40949066 AAGACTGCTCACCTGTGCACAGG - Intergenic
1039909332 8:41811676-41811698 CAGTGTGTTCAACTGCACAGTGG + Intronic
1039983308 8:42427435-42427457 CAGTCTCCTCACCTGTGGACTGG + Intronic
1041035945 8:53790654-53790676 GAGTGTGCTGGCATGTGCAGTGG - Intronic
1041501013 8:58538775-58538797 CAGTGTGCTCACAGCAGCAGAGG + Intergenic
1044558868 8:93593035-93593057 CTGTTTGCTCACCTGTGAAATGG - Intergenic
1045251703 8:100488016-100488038 CACTGAGTTCACCTTTGCAGGGG - Intergenic
1045347407 8:101305424-101305446 CAGTGTCCTCATCTGTGAACTGG + Intergenic
1045931889 8:107636803-107636825 CAGTGTTCTCATCTGTGAACAGG + Intergenic
1047295200 8:123564654-123564676 CAGTTTCATCACCTGTGAAGTGG + Intergenic
1047506837 8:125486785-125486807 CAGTGTTTTCACCTGTACAATGG + Intergenic
1047695877 8:127403227-127403249 TACTGTCCTCACTTGTGCAGTGG - Intergenic
1047821385 8:128525128-128525150 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1048321751 8:133405590-133405612 CAGTTTCCTCACCTGTTCATGGG - Intergenic
1048370770 8:133774177-133774199 CAGTTTCCTCATCTGTGCAGTGG - Intergenic
1048436984 8:134427333-134427355 CAGTTTCCTCACCTGTAGAGTGG - Intergenic
1048536805 8:135303942-135303964 CAGTGTGCTTACTGGGGCAGAGG + Intergenic
1048541996 8:135350464-135350486 CAGTGTTCTCATCTGTACACTGG - Intergenic
1048821252 8:138382597-138382619 CAGTTTTCTCATCTGTGCATAGG + Intronic
1049196235 8:141317206-141317228 CAGTTTTCTCGCCTGTGAAGTGG + Intergenic
1049197009 8:141321173-141321195 CAGTTTCCTCATCTGAGCAGAGG - Intergenic
1049197694 8:141324651-141324673 CAGTCTCCTCACCTGTATAGTGG + Intergenic
1049239672 8:141530792-141530814 CAGTGTGCACAAGTGGGCAGAGG - Intergenic
1049252283 8:141595709-141595731 CAGTTTTCTCACCTGAGCAATGG + Intergenic
1049510279 8:143023865-143023887 CAGTCAGCTCACCTGGGAAGTGG - Intergenic
1049846455 8:144804228-144804250 CTTTGTACTCACCTGTGCACAGG - Exonic
1052027257 9:23587538-23587560 AATTGTGCCCACATGTGCAGTGG + Intergenic
1052331297 9:27271653-27271675 CATGGGGCTCCCCTGTGCAGAGG + Intergenic
1052843470 9:33313733-33313755 CAGTGTGCTGAGCTGTGCCATGG + Exonic
1052997179 9:34557390-34557412 CACTGTACATACCTGTGCAGAGG + Intronic
1053412879 9:37927037-37927059 TAGTCTTCTCATCTGTGCAGTGG - Intronic
1053887623 9:42656401-42656423 CAGTTTTCTCATCTGTTCAGTGG - Intergenic
1054226645 9:62463851-62463873 CAGTTTTCTCATCTGTTCAGTGG - Intergenic
1054595876 9:67065733-67065755 CAGTGTACTTGTCTGTGCAGTGG + Intergenic
1055008205 9:71533839-71533861 CAGCTTGCTCACCTGTGCAAAGG - Intergenic
1056306359 9:85294630-85294652 CAGGGTCCACACCTGGGCAGTGG + Intergenic
1057082125 9:92180932-92180954 AAGTTTTCTCACCCGTGCAGTGG - Intergenic
1057195148 9:93112395-93112417 CGGTGTCCACACTTGTGCAGTGG + Intronic
1057294267 9:93826415-93826437 CCGTTTGCTCATCTGTGAAGAGG - Intergenic
1057777312 9:98021479-98021501 CTGTGTGGTCACTTGAGCAGTGG - Intergenic
1058577455 9:106419174-106419196 CAGTGTCCTCATCTGTGAAATGG + Intergenic
1058834714 9:108850795-108850817 CAGTGTCCTCACCTGTAAAATGG + Intergenic
1058945061 9:109848227-109848249 CAGTGTGCACATCTGTGAAAGGG - Intronic
1059297485 9:113284755-113284777 CAGTGTTCTTACCTGTAAAGTGG + Intronic
1059454556 9:114391467-114391489 CAGTGTCCTCACCTATACAATGG - Intronic
1059581298 9:115551297-115551319 CAGTGTTCTCATCTTTGTAGTGG + Intergenic
1059705665 9:116820962-116820984 CAGTGTGCCCACCTGTAAAATGG + Intronic
1060050503 9:120375181-120375203 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1060051774 9:120383278-120383300 GAGTGTCCTCACCTGGTCAGGGG - Intergenic
1060133047 9:121123713-121123735 CAGTTTTCTCACCTGTAAAGTGG + Intronic
1060182221 9:121542102-121542124 CATTGTCCTCCCCTGTGAAGTGG + Intergenic
1060205706 9:121681593-121681615 CAGTTTCCTCACCTGTGAAATGG - Intronic
1060667786 9:125443302-125443324 CAGTGTCCCCACCTGTAAAGTGG - Intronic
1060799761 9:126536230-126536252 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1061003537 9:127915959-127915981 CTGTGTGGCCAGCTGTGCAGGGG + Intronic
1061005916 9:127928352-127928374 CAGTTTTCCCATCTGTGCAGTGG - Intronic
1061017995 9:127993864-127993886 CAGTCTCCTCACCTGTGAAATGG - Intergenic
1061042884 9:128149937-128149959 CAGTTTCCTCATCTGTGCAGGGG - Intronic
1061181507 9:129027655-129027677 CAGTCTCCGCACCTGTGCAATGG - Intronic
1061309085 9:129750762-129750784 CAGTGTCCTCACCTGTAAACGGG - Intronic
1061391606 9:130320139-130320161 CAGTTTGCTCATCTGTGGAATGG - Intronic
1061422565 9:130480196-130480218 CAGTTTCCCCACCTGTCCAGTGG + Intronic
1062029885 9:134357445-134357467 CAGATTTCTCGCCTGTGCAGGGG + Intronic
1062439630 9:136563957-136563979 CCATGTTCTCACCTGTACAGTGG + Intergenic
1062521097 9:136958322-136958344 CAGTTTCCCCATCTGTGCAGAGG - Intergenic
1202797626 9_KI270719v1_random:139127-139149 CAGTTTTCTCACCTGTGCAATGG - Intergenic
1185460949 X:332609-332631 CCGAGGGCTCACGTGTGCAGGGG - Intergenic
1186219415 X:7333746-7333768 CTGTTTTCTCATCTGTGCAGTGG + Intronic
1186489652 X:9961487-9961509 CAGTCAGCTCACCTGGCCAGCGG - Intergenic
1186755568 X:12667872-12667894 CACAGTGCTCATCTCTGCAGGGG - Intronic
1187205277 X:17175912-17175934 CTGTGTCCTCACCTGGGCTGTGG - Intergenic
1187407365 X:19015926-19015948 CACTGGGCTCAACTGTGAAGAGG + Intronic
1188941391 X:36241821-36241843 CAGGGGGCTCACTTGGGCAGAGG - Intronic
1188989769 X:36803344-36803366 CAGGCTGTCCACCTGTGCAGTGG - Intergenic
1189173348 X:38930704-38930726 CAGTTTTCTCACCTGTAAAGTGG + Intergenic
1189677752 X:43479695-43479717 CAGTCTCCTCATCTGTGAAGTGG + Intergenic
1190217848 X:48492127-48492149 GAGTATGCTCACGTGTTCAGCGG + Intergenic
1190340653 X:49292812-49292834 CAGTCTCCTCACCTGTGCAATGG + Intronic
1190627101 X:52346639-52346661 CAGTCTCCTCACCTGTGCAATGG + Intergenic
1190691004 X:52913164-52913186 GACTGTGCACACCTGGGCAGAGG + Intergenic
1190694979 X:52942628-52942650 GACTGTGCACACCTGGGCAGAGG - Intronic
1191754449 X:64579380-64579402 CAGTTTTCTCATCTGTGAAGTGG + Intergenic
1192227504 X:69239144-69239166 CAGTTTGCTCACTTGTGAAATGG - Intergenic
1194399426 X:93424631-93424653 CAGTGTTCTTATCTGTGCAAGGG - Intergenic
1194981804 X:100449240-100449262 CAGTGTCCTCATCTGTACAGTGG + Intergenic
1196428078 X:115592082-115592104 CAGTGTGGGCACCTGTGAAAAGG - Intronic
1197719715 X:129737023-129737045 CAGTGTCCTCACCTGTGAGTTGG - Intergenic
1198137924 X:133772818-133772840 CAGTTTTCTCACCTATGAAGTGG - Intronic
1198808366 X:140510304-140510326 CACAGCGCTCACCTGTACAGAGG + Intergenic
1199009124 X:142738553-142738575 ATGTGTGCTAACCTGTGGAGGGG + Intergenic
1199671506 X:150151901-150151923 CAGTTTCCTCACCTGTGAAATGG - Intergenic
1199886996 X:152030109-152030131 CAGTGTTATCACATCTGCAGTGG + Intergenic
1200063590 X:153494640-153494662 CAGTGTCCCCATCTGGGCAGTGG + Intronic
1200958381 Y:8973156-8973178 CAGGGGGCTCGCGTGTGCAGCGG + Intergenic
1202603942 Y:26622815-26622837 CAGAGAGCTCTCCTGGGCAGTGG + Intergenic