ID: 1139418410

View in Genome Browser
Species Human (GRCh38)
Location 16:66832528-66832550
Sequence GTTCCATGGGAGCTGGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139418410_1139418418 -3 Left 1139418410 16:66832528-66832550 CCCTTACCCAGCTCCCATGGAAC 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1139418418 16:66832548-66832570 AACACACTGATGGGAAACAGAGG 0: 1
1: 0
2: 3
3: 28
4: 258
1139418410_1139418419 4 Left 1139418410 16:66832528-66832550 CCCTTACCCAGCTCCCATGGAAC 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1139418419 16:66832555-66832577 TGATGGGAAACAGAGGTGTGAGG 0: 1
1: 1
2: 3
3: 36
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139418410 Original CRISPR GTTCCATGGGAGCTGGGTAA GGG (reversed) Intronic
900392319 1:2439032-2439054 GGACCCTGGGAGCTGGGTCAGGG - Intronic
901796792 1:11684161-11684183 GTTCCATGGGGGCGGGGGCAGGG + Intronic
902078520 1:13805548-13805570 ATTCCCTGGGGGCTGGGTGAGGG - Intronic
902810774 1:18886626-18886648 GTTTCATGGGAGCGGGGGAGGGG - Intronic
903229186 1:21911569-21911591 CTTCCCAGGGAACTGGGTAAAGG - Intronic
904296606 1:29523449-29523471 GTTCCCTGGGAGCAGGAGAATGG + Intergenic
904347214 1:29880807-29880829 TTTACATGGGAGGTGGGTAGAGG - Intergenic
906561483 1:46761213-46761235 GTTCCATGAGGGCTGAGTTAAGG + Intronic
906636697 1:47415218-47415240 GTTCCCTTGGAGCTGGGGATGGG + Intergenic
907714851 1:56917085-56917107 GTTCCATGGAAGATGGATAGCGG - Intronic
915928191 1:160040503-160040525 TTTCCATGGGGCCTGGGTACTGG + Exonic
916294090 1:163197529-163197551 TTTCCATGGGAGCAGGGCATGGG + Intronic
917576104 1:176323325-176323347 ATTCCCTGGGAGCTGAGGAAAGG - Intergenic
917594366 1:176514298-176514320 TTCCCATGGGAGCTGTTTAAAGG - Intronic
921657354 1:217756497-217756519 GTTTCAAGGGAGCTGAGAAAGGG + Intronic
922768209 1:228166774-228166796 GGTCCCTGGAAGCTGGGCAAGGG - Intronic
923648198 1:235845678-235845700 TTTGCGTGGGAGCTGGGTGAGGG + Intronic
1063971332 10:11383136-11383158 GTTCCCTGGGAGCTGGGGTTGGG - Intergenic
1064122655 10:12633273-12633295 GTCCCATGGGAGGAGGTTAATGG + Intronic
1064387492 10:14910158-14910180 GGAACATGGGAGCTGGATAATGG - Intronic
1065294719 10:24263334-24263356 GTTTCATGGGGGCTGGGGGAAGG + Intronic
1065685139 10:28276792-28276814 GAACAATGGGATCTGGGTAAAGG + Intronic
1066986676 10:42474831-42474853 GTTCCACAGAAGCTGGGGAAAGG + Intergenic
1068386217 10:56331106-56331128 GTTGCTTTGGAACTGGGTAATGG - Intergenic
1069279854 10:66641408-66641430 TTTCCATTGAATCTGGGTAAGGG + Intronic
1069799398 10:71072791-71072813 GTTCTCTGGGAGCTGAGGAAGGG + Intergenic
1071559998 10:86638287-86638309 TTTCCTTGGGAACTGTGTAATGG + Intergenic
1071811156 10:89182944-89182966 GATCCATGGGAACTGGAAAATGG - Intergenic
1072716184 10:97754078-97754100 GTCAGATGGGAGCAGGGTAAGGG + Intronic
1072838555 10:98743882-98743904 ATTTCTTGGGAACTGGGTAATGG - Exonic
1073111562 10:101065964-101065986 TTCCTATGGGAGCTGGGGAAGGG - Intronic
1073144882 10:101273980-101274002 GTACTATGGGAGCTGGGAACAGG + Intergenic
1074497261 10:113991068-113991090 GTTTCATGGGAGCCAGGGAAGGG + Intergenic
1076517427 10:131055492-131055514 CTTCGACAGGAGCTGGGTAAGGG + Intergenic
1080677375 11:34440097-34440119 GTTCCCTGGCTGCTGGTTAATGG + Intronic
1081986135 11:47305778-47305800 GTTCCAGGGAAGCAGGGTACTGG + Intronic
1083102801 11:60327541-60327563 GTGGCATTGGAACTGGGTAATGG + Intergenic
1083132075 11:60633948-60633970 CTCCCATGGGAGCTTGGCAAGGG + Intergenic
1086949771 11:92880164-92880186 GGACCAGGGGAGCTGGGCAAAGG + Intronic
1087618786 11:100519112-100519134 GATACATTGGAACTGGGTAATGG - Intergenic
1090920669 11:131203611-131203633 TTGCCATGGGAGGTGGGTCAGGG - Intergenic
1091168434 11:133500622-133500644 CTGCCATGGGAGCTGGCTAGTGG - Intronic
1093130122 12:15381678-15381700 TTTCCATGGGAGCTGCGAAAGGG - Intronic
1095892751 12:47249961-47249983 TTTGCATGAGAGCTGGGTGAGGG + Intergenic
1095949471 12:47773878-47773900 CTTCCCTGGGTGCTGGGTGAGGG + Intronic
1096686183 12:53289643-53289665 CTTACTTGGGAGCTGGGTGAAGG + Intronic
1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG + Intergenic
1098161595 12:67650723-67650745 GATCCCTGGGAGCTGAGAAAAGG - Intronic
1101051965 12:100873262-100873284 GTGCCTTTGGAACTGGGTAATGG + Intronic
1101635293 12:106535569-106535591 TTTGCATGGGAGCTGGGTGAGGG - Intronic
1102795880 12:115688428-115688450 GTGCCATGGGAGCAGAGAAAAGG - Intergenic
1103853764 12:123950481-123950503 GTTCCTAGGAAGCTGGGTGAGGG + Intronic
1107694341 13:42985903-42985925 CTTCCATGGGTTCTGGGCAAGGG - Intronic
1107740559 13:43445707-43445729 GTTCCATGTGCCCTTGGTAATGG - Intronic
1107741651 13:43456593-43456615 GTTCCCTGGGAGCTATGTCAGGG + Intronic
1108090690 13:46846643-46846665 GTGCCAAGGGTGCTGAGTAATGG + Intronic
1110068033 13:71133581-71133603 GTTACCTGGAAGCTGGATAAAGG + Intergenic
1113588378 13:111481114-111481136 GTTCCCCGGCAGCTGGGCAACGG - Intergenic
1117639821 14:57786108-57786130 TTTGCGTGGGAGCTGGGTGAGGG + Intronic
1121022935 14:90592786-90592808 GTGCCCTGGGAACTGGGGAAGGG + Intronic
1122805452 14:104254064-104254086 GGTCCCCGGGAGCTGAGTAAGGG + Intergenic
1124471248 15:29988002-29988024 GTTCCATGTGACCTGGGTACAGG - Intergenic
1124910536 15:33915875-33915897 GCAGCGTGGGAGCTGGGTAAGGG + Intronic
1127482472 15:59390301-59390323 TTTCCATGTCAGATGGGTAATGG - Intronic
1128329189 15:66744846-66744868 GTCCCATAGGAGCTGGGGACAGG - Intronic
1128441579 15:67714395-67714417 TTTCCCTGGCAGCTGGGTAGGGG - Intronic
1132086463 15:98912153-98912175 TTAACATGGGACCTGGGTAAGGG - Intronic
1134058589 16:11185436-11185458 GTTCTGTGGGAGCTGGGTGCAGG + Intergenic
1134430346 16:14198662-14198684 GTTCCAAGTGAGATGGGTAAAGG - Intronic
1134884626 16:17778835-17778857 GTTCCTTGGCGGCTGGGTATGGG - Intergenic
1135305466 16:21364166-21364188 TGTCCAGGGGACCTGGGTAAAGG - Intergenic
1136055271 16:27683668-27683690 GTGAGATGGGAGCTGGGAAAGGG + Intronic
1136302204 16:29343318-29343340 TGTCCAGGGGACCTGGGTAAAGG - Intergenic
1139418410 16:66832528-66832550 GTTCCATGGGAGCTGGGTAAGGG - Intronic
1141156653 16:81601712-81601734 CTTCCATGGGAGCTGGAGAATGG - Intronic
1141469420 16:84228528-84228550 GGCCCATGGGAGCGGAGTAAAGG - Intronic
1141569565 16:84926003-84926025 ATTCGATGGGAGCTGGGTCATGG - Intergenic
1142330827 16:89452317-89452339 GCTCCAGGGGAGTGGGGTAAGGG - Intronic
1143579322 17:7816283-7816305 GTTTCAGGGTAGCTGGGTAGGGG - Intronic
1151040937 17:70860524-70860546 GCAACATGGGAACTGGGTAACGG + Intergenic
1151895867 17:76980623-76980645 AGCCCACGGGAGCTGGGTAATGG + Intergenic
1153952289 18:10067664-10067686 CTCCCAGGGGAGCTGGGTAAGGG - Intergenic
1158225227 18:55194125-55194147 TTTCCATGGTAGGTGGGTAGAGG - Intergenic
1158911054 18:62062942-62062964 ATTCCATGAGGGCTGTGTAAAGG + Intronic
1160325045 18:77938516-77938538 TTTTAATGGGAGCTGGGTTAAGG - Intergenic
1161715556 19:5874251-5874273 GTTCCTTGGGAGGTGGGAATGGG + Intronic
1163020564 19:14478957-14478979 GGTCCCTGGGAGCTGGGAAGTGG + Intronic
1163630034 19:18413606-18413628 CGGCCATGGGAGCTGGGGAAGGG + Intergenic
1164444958 19:28309067-28309089 GTTCCATGGGTGCTGGGGTGGGG - Intergenic
1166976582 19:46608464-46608486 GTTCCCTGGAAGGTGGGGAAAGG - Exonic
925118170 2:1397892-1397914 GCCCCATGGGAGCTGGATAAAGG - Intronic
925546025 2:5017677-5017699 ATTCCATGGGACCTGTGTGAAGG + Intergenic
926638118 2:15206003-15206025 GCACCATTGGAACTGGGTAATGG + Intronic
928162514 2:28941000-28941022 GGTCTCTGGGAGCTGGGAAAAGG + Intronic
928722854 2:34140715-34140737 GTTGCATTGGAGCTGGAAAATGG + Intergenic
928749802 2:34458243-34458265 GTGACTTTGGAGCTGGGTAATGG + Intergenic
929463697 2:42125910-42125932 GGTCTCTGGGAGCTGGGTCAAGG + Intergenic
933157308 2:78990607-78990629 GTGTCATGGGAGCTGTGTAAAGG - Intergenic
933687879 2:85157793-85157815 GGACCAGGGGAGCTGGGTAGGGG + Intronic
935577473 2:104725740-104725762 GATTCATGGGAGATGGTTAATGG + Intergenic
936064621 2:109321013-109321035 GTTCCATGGGAGCTCAAAAATGG + Intronic
937688244 2:124722646-124722668 CATCCATAGGAGTTGGGTAATGG + Intronic
939862088 2:147432673-147432695 GATCCATGGGATCTGGATTAAGG + Intergenic
942002859 2:171666625-171666647 GGTGCATGGGAGGTGGGTGAGGG + Intergenic
948495474 2:238345903-238345925 GTGCCTTGGGTTCTGGGTAACGG + Intronic
1169369964 20:5021082-5021104 GTACCTTCGGAGCTGGGTTATGG - Intergenic
1170436323 20:16333322-16333344 GTGGCATGAGAGCTGGGTAGTGG - Intronic
1171182430 20:23100674-23100696 GTTTCATGTGAGATGAGTAACGG + Intergenic
1172068835 20:32241457-32241479 GTTCTATGGGAGCTCAGAAAAGG - Intergenic
1172684299 20:36742113-36742135 GTATCATGGGAGCTGGGGAAAGG - Intronic
1173701210 20:45073495-45073517 GTAGTATAGGAGCTGGGTAAAGG - Intronic
1173978790 20:47207250-47207272 GTTGAATGTGAGCTGGGTGAGGG - Intergenic
1175012291 20:55750765-55750787 GTTCCTTGGGATCTGGGTCATGG - Intergenic
1181042599 22:20199319-20199341 GATGAATGGGAGCTGGGTGAGGG - Intergenic
1182908541 22:33959515-33959537 GTTACATTGGACCTGGGTTAAGG - Intergenic
1185043992 22:48519841-48519863 GTGCCATGGAAACAGGGTAATGG + Intronic
953180251 3:40588398-40588420 GCTCCTTGGGAGATTGGTAAGGG + Intergenic
953495175 3:43379693-43379715 GCTGCATAGGAGCTGGGTGAGGG + Intronic
954197375 3:49004743-49004765 CTTCCAGGGGAGGTGGGTAGGGG + Intronic
954450015 3:50566801-50566823 CTTCCAGGGGAGGAGGGTAAAGG - Intronic
954965879 3:54610487-54610509 ATTCAGTGGGAGCTGGGTGATGG + Intronic
959699319 3:109283416-109283438 GTTCCATGTCAGCTAGGCAATGG - Intergenic
960447321 3:117764127-117764149 ATTTCATGGCAGCTGGGAAATGG - Intergenic
962613933 3:137105189-137105211 AGTCCATGGGAACTGGATAACGG + Intergenic
964111209 3:153089680-153089702 GTTCCTTGGGTGTTGGGGAAGGG - Intergenic
964628243 3:158779907-158779929 ATTCCACAGGAGGTGGGTAAGGG - Intronic
966453073 3:180084550-180084572 GTGCCTTTGGAACTGGGTAATGG + Intergenic
966686657 3:182703275-182703297 TTTGCAGGGGAGCTGGGTGAGGG - Intergenic
968200934 3:196754709-196754731 GTTCCAGCGGGGCTGTGTAAGGG - Intronic
968655406 4:1776443-1776465 ATGCCAGGGGAGCTGGGTACGGG - Intergenic
969721638 4:8895514-8895536 GGCCCAGGGCAGCTGGGTAAGGG + Intergenic
970374628 4:15444415-15444437 GTTGCATGGCGGCTGGGCAAAGG + Exonic
972302393 4:37797336-37797358 GTTCCTTAGGAGCTGGGTGTGGG + Intergenic
976848655 4:89519143-89519165 CTCCCATGGGAGATGGGTACCGG - Intergenic
977904137 4:102456182-102456204 GCTGCTTGGGAACTGGGTAATGG - Intergenic
982717056 4:158819965-158819987 GTTTCATAGGAGCAGGGTTATGG + Intronic
986981103 5:13448859-13448881 GTTTGATGTGAGCTGGATAAGGG - Intergenic
989595839 5:43155394-43155416 GTACCTTGGGAGCTGTGTCAGGG + Intronic
990037396 5:51338392-51338414 GATCCATGGGAGCGGGGACAAGG - Intergenic
994051325 5:95365776-95365798 GTTCCGTGGGAGCTGGGTGAGGG - Intergenic
994839254 5:104900569-104900591 GTTGCCTTGGAGCTGGGAAATGG - Intergenic
997090037 5:130846073-130846095 GTGGCTTTGGAGCTGGGTAATGG - Intergenic
997473649 5:134130445-134130467 GTGCCAGGGGAGCTGGGCCAAGG + Intronic
997922911 5:137999580-137999602 GTTGCTTTGGAACTGGGTAATGG - Intronic
998133336 5:139661965-139661987 GATACAGGGGAGCTGGGAAAAGG + Intronic
998976940 5:147658963-147658985 GTTCCATGGGAGCATGGGAGTGG + Intronic
999497726 5:152116673-152116695 TTTCCATGGGAGAAGGGAAAAGG + Intergenic
999547094 5:152641642-152641664 GTTACATAGGAGCAGGGGAAGGG + Intergenic
1002214357 5:177619336-177619358 GTTCCATGAGAACTTGGTGAGGG - Intergenic
1004051892 6:12090534-12090556 CTTCCATGGGAGCTCTGGAAGGG + Intronic
1004673757 6:17821996-17822018 GCTCCACTGGAACTGGGTAAAGG + Intronic
1005532480 6:26721900-26721922 GTTCTTTGGGTCCTGGGTAATGG + Intergenic
1005535920 6:26755694-26755716 GTTCTTTGGGTCCTGGGTAATGG - Intergenic
1005538315 6:26779765-26779787 GTTCTTTGGGTCCTGGGTAATGG - Intergenic
1006627653 6:35408837-35408859 ATTTAATGTGAGCTGGGTAAAGG - Intronic
1008192249 6:48474769-48474791 GGTGCAGGGGAGCTGGGTGAGGG - Intergenic
1008292611 6:49736251-49736273 GTTTCATTTGAGCTGTGTAATGG - Intronic
1008919850 6:56831474-56831496 TTTCAGTGGGAGCTGGGGAAGGG - Intronic
1009006954 6:57799353-57799375 GTTCTTTGGGTCCTGGGTAATGG - Intergenic
1009009167 6:57822115-57822137 GTTCTTTGGGTCCTGGGTAATGG - Intergenic
1015593461 6:134844013-134844035 TTTCCATGGGAGTGGGGTGAGGG + Intergenic
1017443232 6:154483992-154484014 GTTTTATGGGATCTGGGGAAAGG + Intronic
1019155575 6:170036797-170036819 GCTGCTTTGGAGCTGGGTAAAGG - Intergenic
1020063581 7:5170442-5170464 GTGGCATGGGTGCTGGGAAAAGG + Intergenic
1024174741 7:46827607-46827629 GCTCCGTGGGAGCTAGGTGAGGG + Intergenic
1025093978 7:56083765-56083787 GCTCTCTGGGAGCAGGGTAAGGG - Intronic
1026219702 7:68383004-68383026 GTTCCAGGGCAGCTGGGAAGAGG - Intergenic
1026227685 7:68457178-68457200 GTTCCCTGACTGCTGGGTAAGGG - Intergenic
1026445604 7:70482075-70482097 TTTCCATGGGAGGTGGGGATGGG + Intronic
1026673814 7:72412664-72412686 GTTCCATGGGGGAAGGGTGAGGG - Intronic
1027689480 7:81324803-81324825 ATTCCATGGGAACTTAGTAAAGG - Intergenic
1031407872 7:121407232-121407254 GTTCCCTGGGAGTTGGGCAGAGG + Intergenic
1034753917 7:153596542-153596564 GTTGCATGGGAGGTAGGAAAGGG - Intergenic
1037628257 8:20627688-20627710 TTTCCATGGCAGCAGGGGAAAGG + Intergenic
1038065924 8:23963679-23963701 GTTCCTTGAGTGATGGGTAAAGG + Intergenic
1038348606 8:26755684-26755706 GTGCCATGGGAGCTTGGTGAAGG - Intronic
1038407977 8:27336040-27336062 GTGTCATGGGAGCTGGAGAATGG + Intronic
1041316685 8:56570689-56570711 GTTCCAGCAGAGCTGGGTACTGG - Intergenic
1045336287 8:101206260-101206282 TTTCCATGGGAGTGAGGTAAAGG - Intergenic
1047756595 8:127923692-127923714 GTTCCACGGGAGCTGGGAAGAGG + Intergenic
1049247655 8:141571350-141571372 GTGCCATGGGAGCTGGGGACAGG - Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1050430558 9:5557607-5557629 GTTCCATCTGACCTGGGCAAAGG - Exonic
1053083629 9:35198589-35198611 GTGACTTGGGAACTGGGTAATGG + Intronic
1055337362 9:75246508-75246530 GTTACTTTGGAACTGGGTAACGG + Intergenic
1055905834 9:81292575-81292597 ATTGCATGGGAGCTGGGTGAGGG - Intergenic
1056277862 9:85011028-85011050 GTTCCCTGGGAGTTGGCTAAGGG - Intronic
1057180353 9:93026518-93026540 GCTCCATGGGAGCTGGTGCAGGG + Intronic
1058434275 9:104947923-104947945 TTTCCAGGGCAGATGGGTAAAGG + Intergenic
1061891936 9:133626549-133626571 GTTACTTTGGAACTGGGTAATGG - Intergenic
1062546683 9:137066709-137066731 TCTCCAAGGCAGCTGGGTAAGGG + Intronic
1192963809 X:76156514-76156536 ATCCCATGGGAGCTGGGCAAAGG - Intergenic
1193404235 X:81082503-81082525 GTTGCATGGGAGCTAGGTGAGGG + Intergenic
1193680993 X:84518771-84518793 GTTGTGTGGGAGCTGGGTGAGGG - Intergenic
1194843505 X:98775283-98775305 GTGACATTGGAACTGGGTAACGG + Intergenic
1195738772 X:108040932-108040954 GTTCCATGTGAGCCTGGGAAAGG + Intergenic
1195738823 X:108041638-108041660 GTTCCATGTGAGCCTGGGAAAGG + Intergenic
1198588455 X:138149052-138149074 GTGGCTTTGGAGCTGGGTAATGG + Intergenic
1199057879 X:143319216-143319238 TCTGCATGGGAGCTGGGTGAGGG - Intergenic
1200861977 Y:8002806-8002828 GTTCTCTGGGAGCTGGGCACAGG + Intergenic
1200874683 Y:8140551-8140573 GTACCAAGGGACCTAGGTAATGG - Intergenic
1201855989 Y:18542961-18542983 TTTCCTTGGGAGCTGGATATGGG + Intergenic
1201877332 Y:18777424-18777446 TTTCCTTGGGAGCTGGATATGGG - Intronic