ID: 1139428172

View in Genome Browser
Species Human (GRCh38)
Location 16:66895932-66895954
Sequence GGTGAGGGGGAGCCATGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139428172_1139428182 11 Left 1139428172 16:66895932-66895954 CCGAACCATGGCTCCCCCTCACC No data
Right 1139428182 16:66895966-66895988 AGCTCAGACTCCCTCTCCCCAGG No data
1139428172_1139428184 15 Left 1139428172 16:66895932-66895954 CCGAACCATGGCTCCCCCTCACC No data
Right 1139428184 16:66895970-66895992 CAGACTCCCTCTCCCCAGGGTGG No data
1139428172_1139428183 12 Left 1139428172 16:66895932-66895954 CCGAACCATGGCTCCCCCTCACC No data
Right 1139428183 16:66895967-66895989 GCTCAGACTCCCTCTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139428172 Original CRISPR GGTGAGGGGGAGCCATGGTT CGG (reversed) Intergenic
No off target data available for this crispr