ID: 1139428630

View in Genome Browser
Species Human (GRCh38)
Location 16:66899312-66899334
Sequence TCCACCTGCTCCCCAAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139428628_1139428630 11 Left 1139428628 16:66899278-66899300 CCGAATAGGTATTGATTTGATAA No data
Right 1139428630 16:66899312-66899334 TCCACCTGCTCCCCAAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139428630 Original CRISPR TCCACCTGCTCCCCAAAGGC CGG Intergenic
No off target data available for this crispr