ID: 1139429156

View in Genome Browser
Species Human (GRCh38)
Location 16:66901842-66901864
Sequence AGAATAACCCTTGTGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139429151_1139429156 -7 Left 1139429151 16:66901826-66901848 CCTGTGCCTGCCACTCAGAATAA No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data
1139429149_1139429156 -1 Left 1139429149 16:66901820-66901842 CCTGGCCCTGTGCCTGCCACTCA No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data
1139429145_1139429156 18 Left 1139429145 16:66901801-66901823 CCACCTGACTGAGGCCAGGCCTG No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data
1139429150_1139429156 -6 Left 1139429150 16:66901825-66901847 CCCTGTGCCTGCCACTCAGAATA No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data
1139429148_1139429156 4 Left 1139429148 16:66901815-66901837 CCAGGCCTGGCCCTGTGCCTGCC No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data
1139429142_1139429156 29 Left 1139429142 16:66901790-66901812 CCAGCTCAGGTCCACCTGACTGA No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data
1139429147_1139429156 15 Left 1139429147 16:66901804-66901826 CCTGACTGAGGCCAGGCCTGGCC No data
Right 1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139429156 Original CRISPR AGAATAACCCTTGTGGTTCT GGG Intergenic
No off target data available for this crispr