ID: 1139430432

View in Genome Browser
Species Human (GRCh38)
Location 16:66908262-66908284
Sequence TCCACCCCAGGGCAGATGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139430426_1139430432 -2 Left 1139430426 16:66908241-66908263 CCTGGTGATGGTGATGGTGCCTC 0: 1
1: 0
2: 1
3: 44
4: 355
Right 1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 286
1139430422_1139430432 16 Left 1139430422 16:66908223-66908245 CCAGGCTCTGCAGACATGCCTGG 0: 1
1: 0
2: 4
3: 48
4: 475
Right 1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139430432 Original CRISPR TCCACCCCAGGGCAGATGGA GGG Exonic
900515109 1:3078039-3078061 TCCACCCCAGGACAGAGGCAAGG - Intronic
902183027 1:14704116-14704138 TCCATCCCAGGGGAGGTAGAGGG - Intronic
902404457 1:16175178-16175200 GGCACCCCAGGGCCCATGGAGGG - Intergenic
902787637 1:18743415-18743437 TCCTGCCCAGGGCAGGTGGGTGG - Intronic
904339463 1:29824757-29824779 GCCACCCCAGGCCAGAGGCAGGG + Intergenic
905822886 1:41007467-41007489 CACAACCCAGGGCAGATGGGCGG + Exonic
905919954 1:41712777-41712799 TTCTCCCCAGGGAGGATGGAGGG - Intronic
905957742 1:42013090-42013112 TCCTCCCGAGGGCTGAAGGAAGG + Intronic
906149116 1:43577500-43577522 TCTAACCCAGGGCAGCAGGAGGG - Intronic
906544551 1:46612062-46612084 CCCACCCGAGGGCAGCAGGAGGG - Intronic
907194628 1:52676526-52676548 ACCACCCCAGGGCAGCTTCAAGG + Intergenic
907283117 1:53363484-53363506 ACCACCCCCAGGCAGAGGGAGGG - Intergenic
907554668 1:55333864-55333886 TGCCTCCAAGGGCAGATGGAAGG - Intergenic
908055510 1:60281810-60281832 TTCTCCCCAGGGCAGATCAAAGG + Intergenic
909282124 1:73770059-73770081 TCCACCCCAGGCCAGAAGCATGG - Intergenic
910805193 1:91182849-91182871 TACACACCAGGGCATGTGGAAGG - Intergenic
912449088 1:109758620-109758642 GCCAGGCCAGGACAGATGGAGGG - Exonic
912472816 1:109917218-109917240 CCCAACCCCAGGCAGATGGAGGG - Intronic
913231955 1:116747263-116747285 TTCATCCCAGAGCAGATGTATGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915350820 1:155224315-155224337 TACAGCCCAGTGCAGATGGAAGG + Intergenic
916289909 1:163154009-163154031 TGCCCCCCAGGGCAGAAGGAAGG + Intronic
916743246 1:167664244-167664266 TCCAGCCCAGGGCAGCTGCCAGG - Intronic
916821486 1:168403153-168403175 TCTTTCCCAGAGCAGATGGATGG + Intergenic
917483615 1:175434487-175434509 TCAACTCCAGGGCAAATGGCGGG - Intronic
917503161 1:175604232-175604254 TTCAGCCCAGCGGAGATGGATGG + Intronic
918140149 1:181713202-181713224 GACCCCCCAGGACAGATGGAAGG - Intronic
920052604 1:203172776-203172798 CCCACCCCAGGGGACAGGGATGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921363186 1:214349321-214349343 TCCACCACAGCCCAAATGGAGGG - Exonic
922208253 1:223467616-223467638 ACTTCCCCAGGACAGATGGAAGG - Intergenic
1062892473 10:1074535-1074557 TCCCGCCCAGGGCAGGGGGAAGG - Intronic
1063188128 10:3668588-3668610 TTTCCCCCAGGGCAGATGCAAGG - Intergenic
1063367415 10:5499634-5499656 CTCACCCCAGGGCATTTGGAGGG - Intergenic
1064873972 10:19971938-19971960 TAAAGCACAGGGCAGATGGAGGG + Intronic
1065934472 10:30508803-30508825 TCCACCCCAGGCCAGAGGAAAGG - Intergenic
1067243421 10:44516296-44516318 TCCAGCCCAGGGCAGAGGTTGGG + Intergenic
1069635605 10:69923005-69923027 TCTTCCCTGGGGCAGATGGATGG + Intronic
1069747747 10:70726608-70726630 CCCACCCCAGTACAGAAGGAAGG + Intronic
1069960240 10:72075148-72075170 TCCACCCCACAGGAGATGGAGGG + Intronic
1070783389 10:79150042-79150064 CCCAGCCCAGGGGAGAGGGAGGG - Intronic
1071462818 10:85914537-85914559 TGCACCCCACGGTAAATGGACGG + Intronic
1072039034 10:91590392-91590414 ACCACCCCAGGGGAGAAGCATGG - Intergenic
1072789224 10:98305545-98305567 TCCAACCCACGGCCCATGGATGG + Intergenic
1073935238 10:108623435-108623457 TCCACCTTAGGGTAGATAGAAGG - Intergenic
1075441338 10:122481496-122481518 CCCCTCACAGGGCAGATGGAGGG + Intronic
1076124574 10:127963649-127963671 TCCACCCCAGGTGAGATCGGAGG - Intronic
1076829992 10:132989222-132989244 TCCACACCAGGGCACAGAGAGGG - Intergenic
1077192824 11:1262578-1262600 TGCCCCCCAGGGCAGGTGCACGG + Intergenic
1079241855 11:18727311-18727333 GTCACCCCAGGGCAGAAGGAGGG - Intergenic
1081618658 11:44605444-44605466 TCCAGCCCAGTGAAGAGGGAGGG - Intronic
1083202951 11:61131409-61131431 CAAACCCCAGGGGAGATGGAGGG + Exonic
1083308619 11:61773407-61773429 TCCCTCCCCGGGCAGACGGAGGG + Intronic
1083707582 11:64526732-64526754 TTCCCCACAAGGCAGATGGAGGG + Intergenic
1084872209 11:72105926-72105948 TCCACCCCAGGGCCCAGGTAGGG + Exonic
1085828465 11:79873437-79873459 TCCACCCCAGGCCAGATAGTGGG + Intergenic
1089916350 11:122160796-122160818 TGCACACCAAGGCAGTTGGAAGG + Intergenic
1090185157 11:124734045-124734067 TCTACCTCTGGGCAGAAGGAAGG - Intergenic
1091411432 12:242636-242658 GCCGCCCCAGGGCAGGTCGATGG + Exonic
1091941850 12:4492609-4492631 TCAGCCCCAGGGCAGAGGGGGGG - Intronic
1092145513 12:6211929-6211951 TCCTCTCCAGGGCAGAGGAAGGG + Intronic
1092171126 12:6374716-6374738 TCCACTCCAGGGCTCATGAAGGG - Exonic
1094848914 12:34373631-34373653 GCCACCCCAAGGCGGAAGGAAGG - Intergenic
1094850881 12:34381855-34381877 TCCAGCCCAAGGCAGCAGGAAGG - Intergenic
1095098152 12:38158826-38158848 ACCACCCCAGGCCCGATGCAGGG - Intergenic
1095162242 12:38932341-38932363 TTCACCCCTGAGCAGATGTATGG - Intergenic
1097878955 12:64669925-64669947 TGCTTTCCAGGGCAGATGGAGGG + Intronic
1098345974 12:69503796-69503818 TGCACCCCAGGGGTGATGTAGGG - Intronic
1101422835 12:104563684-104563706 TCTACCCCATGGAAGAAGGATGG - Intronic
1101434038 12:104650011-104650033 TCCCCCACAGTGCAGATGGATGG + Intronic
1103026141 12:117575850-117575872 CCCACCACAGGGCTGTTGGAAGG - Intronic
1103253781 12:119523056-119523078 TACACCCCTGGGAAGATAGAGGG - Intronic
1103285501 12:119797819-119797841 GCCATCCCAGGACAGATGGGAGG + Intronic
1103925907 12:124423250-124423272 TCCACCCCAGGGGTGCTGGGTGG + Intronic
1103937123 12:124482666-124482688 GTCACCTGAGGGCAGATGGACGG + Intronic
1104910671 12:132238704-132238726 TCCTCCCCAGGGCTGTGGGAGGG + Intronic
1105225757 13:18430063-18430085 TACACCCCTGAGCAGATGTATGG + Intergenic
1108589007 13:51895693-51895715 CCCATCCCAGGGCAGAGGGTGGG - Intergenic
1110591896 13:77272810-77272832 GCAACCCTAGGGCAGGTGGAAGG - Intronic
1111835782 13:93386793-93386815 TCCACCCCAGAGCCTCTGGAGGG - Intronic
1113018437 13:105855414-105855436 TCCACCCCAAGGTGGGTGGATGG + Intergenic
1113842686 13:113369364-113369386 TCCAACACAGGGCAAAGGGAAGG - Intergenic
1113894781 13:113756919-113756941 TCCACCCCAGGGCCTTTGCATGG + Intergenic
1114567110 14:23640742-23640764 CCCAGCCAAGGGCAGATAGAAGG - Intronic
1118816774 14:69319492-69319514 TTCAGCCCAGGGCTGATGGTTGG + Intronic
1119441395 14:74631130-74631152 TCCTCCCCATGCCAGCTGGACGG + Intergenic
1121319037 14:92980402-92980424 TCCACTCCAAGCCAGGTGGAGGG + Intronic
1121342019 14:93111055-93111077 TCCATCCCTGGGCTGCTGGAAGG + Intronic
1122806585 14:104263000-104263022 CCCAGCCCAGGGCAGAGGGAGGG - Intergenic
1122982859 14:105199418-105199440 TGCAGCCCAGGCCAGATGGTGGG - Intergenic
1123033364 14:105461528-105461550 ACCTCCCCAGGGCTGATGGTTGG - Intronic
1123807442 15:23889214-23889236 TCCCTTCCAGGGCAGCTGGAAGG + Intergenic
1124934332 15:34156100-34156122 TACACCCCCGAGCAGATGTATGG - Intronic
1126319639 15:47408109-47408131 TCCACACCAGGTCACAAGGATGG - Intronic
1126936451 15:53714269-53714291 CTCACCCCTGGGAAGATGGATGG + Intronic
1127256350 15:57296961-57296983 TCCACCCCTGGACAGAAGGTCGG - Intronic
1127712426 15:61613098-61613120 TCCACCTCAGAGAAGGTGGAAGG + Intergenic
1128519879 15:68368208-68368230 TCCACCCCAGAGCAGTGGGGTGG - Intronic
1131260007 15:90883253-90883275 GGCACCCCTGGGCAGATGGCTGG - Exonic
1132300315 15:100771276-100771298 TCCACACCTGGGAAGAGGGAGGG - Intergenic
1132550417 16:551742-551764 CCCACCCCAGGTCAGCAGGAGGG - Intronic
1132571326 16:645666-645688 CCGACCCCAGGGCAGATGGAGGG + Intronic
1132696963 16:1206324-1206346 CTCACCCCAGGGCAGCTGGGAGG + Intronic
1132777440 16:1603176-1603198 TCCTCCCCATGGCTGCTGGATGG + Intronic
1132954147 16:2582243-2582265 TCCACCGCAGAGCAACTGGACGG + Intronic
1132960198 16:2617920-2617942 TCCACCGCAGAGCAACTGGACGG - Intergenic
1132981937 16:2742717-2742739 TCTACCCCTGGGCTGGTGGAAGG + Intergenic
1135635359 16:24071087-24071109 TCCACTCCAGGGCTGATGTGAGG + Intronic
1137683927 16:50372987-50373009 CCCACCCCAGGACAGAGGGCAGG - Intergenic
1137829489 16:51530178-51530200 GCCACCACATGGAAGATGGAAGG - Intergenic
1137982975 16:53085421-53085443 TCCTCCCCAAGGCAGATGTCAGG - Intronic
1138536745 16:57664191-57664213 AGAACCCCAGGGAAGATGGAGGG - Exonic
1139216431 16:65129855-65129877 TCCAGCCTTGGGCAGATGAAAGG - Intergenic
1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG + Exonic
1139574275 16:67831420-67831442 AGAGCCCCAGGGCAGATGGAGGG - Intronic
1140294615 16:73696091-73696113 TCCAGCCAAGGGCAGAGGTAGGG + Intergenic
1141657393 16:85423448-85423470 GCCACCCCAGACCAGCTGGATGG - Intergenic
1142096468 16:88242621-88242643 TTCAGCCCAGAGCAGATGGGAGG + Intergenic
1142362337 16:89633356-89633378 CCCACCCCTGGGCAGATGGGCGG - Intronic
1142401747 16:89862474-89862496 GTGAGCCCAGGGCAGATGGAAGG - Intronic
1142478874 17:205949-205971 CCCTCGCCAGGGGAGATGGACGG - Intergenic
1143253872 17:5541677-5541699 TCCACCCTTGGACAGAGGGAGGG - Intronic
1145251024 17:21297144-21297166 GCCAACCCAGCCCAGATGGAGGG - Intronic
1145987596 17:29057632-29057654 ACCACCCCAGGGTGGGTGGAGGG + Intergenic
1148139163 17:45316535-45316557 TTCACGCCAGGGCAGATGCCAGG + Intronic
1148820000 17:50354779-50354801 CCCACCCCAGGACAGAGTGAAGG - Intronic
1148863921 17:50618892-50618914 TCGACCCCAGGCCAGAGGAAGGG - Exonic
1149612569 17:57968288-57968310 TCTAGCCCAGGGCAGGTGCATGG + Intergenic
1151209671 17:72535155-72535177 TCAACCACAGGGCAGCTGGAGGG + Intergenic
1151508945 17:74546633-74546655 CACACCCCAGGGCACACGGAGGG + Intergenic
1151731159 17:75912125-75912147 TCCAGCTCAGGGCAGAGGCAGGG - Intronic
1152382327 17:79948549-79948571 ACCACCCACGGGGAGATGGAGGG + Intronic
1152458533 17:80429637-80429659 TACAGCCCAGGGCAGAGGGCAGG - Intronic
1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG + Intergenic
1153015771 18:581173-581195 TTCAGCACAGGGCAAATGGAGGG - Exonic
1153596092 18:6726877-6726899 TCCACAGAAGGGCAGAAGGAAGG + Intergenic
1153778186 18:8472013-8472035 ACCAGCCCAGGTCAGATGCAGGG + Intergenic
1154527619 18:15309458-15309480 TACACCCCTGAGCAGATGTATGG - Intergenic
1155717952 18:28970176-28970198 TCCACCACAGGACAGAAGGCTGG + Intergenic
1156457856 18:37304808-37304830 GCCACCCCAGGGCTGATGGAAGG - Intronic
1157617375 18:48995177-48995199 TCCACTCAAGGGCTGATGGGTGG - Intergenic
1159933031 18:74333739-74333761 TCCTCCCTAGGGCATATGGATGG - Intronic
1161087765 19:2343075-2343097 TCATCCCCTGGGCAGGTGGAAGG + Intronic
1162126162 19:8500451-8500473 TTCCCCCCATGGCAGCTGGAGGG + Intronic
1162479362 19:10919761-10919783 GCCGTCCCAGGGCAGATGGTGGG + Intronic
1165070639 19:33253242-33253264 TCCACCCCAGGGCAGGGTGGGGG - Intergenic
1167662520 19:50804303-50804325 TCCGCCGCGGGGCAGACGGAGGG + Intronic
1168317042 19:55488998-55489020 TCCCCACCAGGGCCGCTGGAAGG - Exonic
925793816 2:7521436-7521458 TCCAGACTGGGGCAGATGGAAGG + Intergenic
926752152 2:16206395-16206417 ACCACCACAGGGGAGATGCAGGG + Intergenic
928241083 2:29587109-29587131 TACTCCCCAGGGCAACTGGAGGG + Intronic
929121141 2:38484904-38484926 TCCTCCCCAGAGCAGAAAGAGGG - Intergenic
929797626 2:45072303-45072325 TCCTGCCAAGGGCAGAGGGAGGG - Intergenic
932114825 2:69036865-69036887 TCCACCCTATGGCTGAAGGATGG + Intronic
932620125 2:73260266-73260288 TCCAGCCAAGGGCAGAGGCAGGG - Intronic
933804352 2:85987429-85987451 TCCACCTGAGGGGAGAGGGAGGG + Intergenic
933918959 2:87025565-87025587 TCCACTTCAGGTGAGATGGAAGG - Intergenic
934004035 2:87744349-87744371 TCCACTTCAGGTGAGATGGAAGG + Intergenic
934761408 2:96858922-96858944 TCCACCTCAGGGCAGGGGCAGGG + Intergenic
935832045 2:107010586-107010608 TCAACCTCAGAGCAGCTGGAGGG + Intergenic
937267971 2:120629380-120629402 ACCAGCCCTGGGCAGCTGGAGGG - Intergenic
938097902 2:128475338-128475360 TCCAGGCCACGGCAGCTGGAGGG - Intergenic
939879417 2:147613180-147613202 ACCAACCCAGGGCGGATGGACGG + Intergenic
942749592 2:179272800-179272822 ACCTCTCCAGGGCAGCTGGAAGG - Intergenic
944687623 2:202131796-202131818 TGCACCCCAGGGTACATGCAGGG + Intronic
946026487 2:216674779-216674801 TCCACCCCAGGGAGGATGCAGGG + Exonic
946172004 2:217901165-217901187 TCCATCCCAGGGCAGCAGGATGG + Intronic
946251778 2:218418477-218418499 TTCACCCCAGGGCAGGTGGGAGG + Intergenic
946487366 2:220113860-220113882 TCCACCTCAGGGCCCATGCAAGG - Intergenic
947750739 2:232530679-232530701 CCAACCCCACTGCAGATGGAAGG - Intronic
948185080 2:236014618-236014640 TTCACCGCAGGGGAGTTGGAGGG + Intronic
948232870 2:236365060-236365082 TCCAACGCAGGGCAAATGAATGG - Intronic
948555079 2:238804031-238804053 TCTCCCCCAGGGAAAATGGACGG + Intergenic
948911868 2:241008960-241008982 CCCACCCCAGAGCTGATGGCAGG - Intronic
948967186 2:241392003-241392025 GCCACACCAGGGCTGAGGGAAGG + Intronic
1169188927 20:3644688-3644710 ACCAGCCCAGGGGAGATGGCTGG - Intronic
1170715555 20:18828157-18828179 CCCACCCCAGCTCAGAGGGAGGG - Intronic
1171021048 20:21584422-21584444 GGCTCCCCAGGGAAGATGGAAGG - Intergenic
1171471500 20:25375594-25375616 TCCACGCCATGGCACAGGGAGGG - Intronic
1171484175 20:25475820-25475842 TCTACCACTGGGCAGAGGGAGGG - Intronic
1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG + Intronic
1174141712 20:48419198-48419220 TCCCCCGCAGTCCAGATGGAAGG + Intergenic
1175181081 20:57148169-57148191 TCCACCCCATGCCATAAGGATGG - Intergenic
1175670882 20:60901893-60901915 GCTACCCCTTGGCAGATGGAGGG - Intergenic
1175763010 20:61573830-61573852 TCAAACACAGGACAGATGGAAGG + Intronic
1175825907 20:61936424-61936446 CCAACCCAAGGGCAGATGGGGGG - Intronic
1176094548 20:63333918-63333940 CTCACACCAGGGCAGATGGTGGG + Intronic
1176292821 21:5055314-5055336 GGGACCCCAGGGCAGGTGGATGG - Intergenic
1176769810 21:13059086-13059108 TACACCCCTGAGCAGATGTATGG + Intergenic
1178251972 21:31011773-31011795 TTGAGCCCAGGGCAGAAGGATGG - Intergenic
1179485856 21:41710448-41710470 TCCAGCCCAGGAAACATGGAGGG + Intergenic
1179864439 21:44208336-44208358 GGGACCCCAGGGCAGGTGGATGG + Intergenic
1180733216 22:17997536-17997558 ACCACCCCAGGTCTGATGGGAGG - Intronic
1181002209 22:19993134-19993156 TTCCCCCCAGGGCAAATGCAGGG - Intronic
1181368160 22:22395643-22395665 TCCACTTCAGGGCACAAGGAGGG - Intergenic
1181375934 22:22458002-22458024 TCCATCCCTGAGCAGATGTATGG + Intergenic
1181517934 22:23426697-23426719 ACCACCCCAGGTCTGATGGGAGG - Intergenic
1181978774 22:26751602-26751624 TCCACTTCTGGGCAGAGGGAAGG + Intergenic
1182107417 22:27699342-27699364 TGCACCTCAGGGCAGATGTGAGG - Intergenic
1182831954 22:33311288-33311310 TGCAGCCCAGGCCAGAAGGATGG + Intronic
1183359762 22:37377330-37377352 CCCTGCCCAGGGCAGAGGGAGGG - Intronic
1183599434 22:38831439-38831461 TCATTCCCAGGACAGATGGAAGG + Intronic
1184534944 22:45080091-45080113 TCCACCACAGGCCAGAAGCAGGG - Intergenic
1184781515 22:46651969-46651991 TCCACGCCGGGCCAGGTGGAAGG + Intronic
1184856991 22:47151738-47151760 TCAACCCCAGAGCAGACGCAGGG - Intronic
1185173238 22:49305385-49305407 TCCACCCCAGGCCAGACCCAGGG - Intergenic
951749107 3:26014001-26014023 TCCACCACAGGCAAGATGGCAGG + Intergenic
954279286 3:49564566-49564588 CCCACTCCAGGTCAGATGCAGGG - Intronic
954389363 3:50260676-50260698 TCCCCCTCAGGACAGAAGGAAGG - Intergenic
955397724 3:58569077-58569099 TGCAGGCCAGGGCAGAAGGATGG - Intronic
956204172 3:66738763-66738785 TGCACCGCAGGGCGGGTGGAAGG - Intergenic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
956962013 3:74414097-74414119 TCCACACCTGGGCATGTGGATGG + Intronic
957989106 3:87608445-87608467 TCCATCCCTGAGCAGATGTATGG - Intergenic
960424714 3:117492415-117492437 TTCTCCACAGGGCAGCTGGAAGG - Intergenic
965720401 3:171655132-171655154 TGCAGCCCAAAGCAGATGGAGGG - Intronic
967119634 3:186371384-186371406 GTCACACAAGGGCAGATGGAAGG - Intergenic
968503339 4:961104-961126 GCCACCCCGGTGCAGGTGGACGG - Exonic
969130126 4:4985061-4985083 TCCATCACAGGGAAGATGGAGGG - Intergenic
969622738 4:8286876-8286898 TCCTCCCCCTGGCTGATGGAAGG - Intronic
971231232 4:24801238-24801260 ACCAGCCCAGGTGAGATGGAAGG - Intergenic
974165422 4:58195567-58195589 TCCTCCCCACTGCAAATGGAGGG - Intergenic
976872719 4:89814351-89814373 TCCAACCCTGGGCAGTTGGCTGG + Intronic
977045865 4:92068838-92068860 TCCACCCCTAGTCAGATGTATGG - Intergenic
978190290 4:105903387-105903409 TTCATCACAGGGGAGATGGAAGG + Intronic
985767614 5:1788098-1788120 ACCACCCCAGGGCGGGTGGAGGG - Intergenic
985800205 5:2000952-2000974 CTGACCCCAGGACAGATGGAGGG + Intergenic
986735208 5:10663052-10663074 TCCACCCCAGGGCAGCAGCCCGG + Intergenic
987035806 5:14017271-14017293 TCCACCCAAGGACAGATGCTTGG + Intergenic
987721354 5:21636889-21636911 TCCACCTCAGAGCAGAGAGAAGG - Intergenic
988137187 5:27188948-27188970 TGCAGCCCAGGGCGAATGGAGGG + Intergenic
992946079 5:81811715-81811737 TCCACTCCAGGACACATGGGAGG + Intergenic
994745877 5:103677699-103677721 TCCAGCCCAGGGCATAGGAAGGG + Intergenic
994908302 5:105868739-105868761 ACCCTACCAGGGCAGATGGAGGG + Intergenic
996100237 5:119437729-119437751 TCCCCCCCAGGGAAGGGGGAAGG + Intergenic
996244493 5:121244417-121244439 TCCATGCCGGGGCAAATGGAAGG - Intergenic
997605587 5:135173683-135173705 TGGACCCCAGGGCAGAGGGAAGG - Intronic
998094719 5:139390750-139390772 TCCAGTCCAGGGCAGAGGGCAGG + Exonic
1001080019 5:168660804-168660826 GTCTCCACAGGGCAGATGGAAGG + Intergenic
1001979656 5:176030317-176030339 TCCACCACAGGACTGATGGGAGG - Intronic
1002237761 5:177813446-177813468 TCCACCACAGGACTGATGGGAGG + Intergenic
1002278010 5:178115521-178115543 CCCACCCCAGAGGAGATGCAAGG + Intronic
1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG + Intronic
1002585791 5:180246534-180246556 TCCATCCTTGGGCAGATTGATGG - Intronic
1002699046 5:181109757-181109779 CCCACCCCAGGGCTGCTGGGAGG + Intergenic
1003535314 6:6970939-6970961 ACCACCCCTGGGCAGAAGGGAGG + Intergenic
1003968104 6:11272668-11272690 TGCACACCAAGGCAGGTGGAAGG - Intronic
1004560234 6:16742693-16742715 TACAACCCAGAGGAGATGGATGG + Intronic
1005840617 6:29742588-29742610 TCCACCCCAGGGCTGCTGCTTGG + Intergenic
1005849888 6:29813419-29813441 TCCACCCCAGGGCTGCTGCTTGG + Intergenic
1006060339 6:31414298-31414320 TCCACCCCAGGGCTGCTGCTTGG - Intronic
1006161863 6:32043924-32043946 GGAACCCCAGGGCAGCTGGAGGG + Intronic
1008368774 6:50711144-50711166 GCAACCCCAGAGCAGATGGAAGG + Intergenic
1011977600 6:93324441-93324463 TAAACCCAAGGGCAGATGAAAGG + Intronic
1013722667 6:113049539-113049561 TACTCCCCAGGGCTGAGGGATGG - Intergenic
1014839049 6:126195687-126195709 TCACCCCCAGGGCTGATGAAGGG - Intergenic
1017982290 6:159410908-159410930 TTTACCTCAGGGCAGGTGGATGG + Intergenic
1018127823 6:160698491-160698513 TCCACTTCAGGTGAGATGGAAGG + Intergenic
1018511780 6:164532292-164532314 TCCTCCCCAGGGCTGTGGGATGG - Intergenic
1018989983 6:168667315-168667337 TCCACCCCAGGGCTACCGGAAGG + Exonic
1019345183 7:526324-526346 CACCCCCCAGGGCAGCTGGAAGG + Intergenic
1019428313 7:987554-987576 CCTACCCCAGAGGAGATGGAAGG - Intronic
1019635043 7:2070999-2071021 TTCATCCCAGGGCTGGTGGATGG + Intronic
1019635059 7:2071057-2071079 TTCATCCCAGGGCTGGTGGATGG + Intronic
1020043816 7:5024691-5024713 TTCATCCCAGAGCAGATGTATGG - Intronic
1020077126 7:5265452-5265474 GCCCACCCAGGGCTGATGGAAGG - Intergenic
1020111194 7:5448656-5448678 TCCACCCCTGGACAGGTGCAAGG + Intronic
1020745522 7:12074020-12074042 TTCACCCCCGAGCAGATGTATGG + Intergenic
1022114161 7:27248181-27248203 TCCACCCCAGCCCAAAGGGAAGG + Intergenic
1022537759 7:31108425-31108447 TGCACACCAGTGCAGGTGGAGGG - Exonic
1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG + Intronic
1023276014 7:38519099-38519121 ACCATCCCATGGCAGATGGGTGG - Intronic
1023513106 7:40974092-40974114 CCCACACCAGGGATGATGGAAGG + Intergenic
1023832975 7:44050861-44050883 TCCAGCTCAGGACAGAGGGAGGG - Intronic
1025201984 7:56968195-56968217 GCCCACCCAGGGCTGATGGAAGG + Intergenic
1025669963 7:63608733-63608755 GCCCACCCAGGGCTGATGGAAGG - Intergenic
1026158798 7:67851063-67851085 TCCTTCCCAGAGCATATGGATGG + Intergenic
1027560620 7:79724403-79724425 TCCTCCCCTGCCCAGATGGAAGG - Intergenic
1029481904 7:100818491-100818513 CCCACCCCAGGGCTGGGGGATGG + Intronic
1030313822 7:108094013-108094035 GCCACCTCAGGGCAGATCCAGGG + Intronic
1031952395 7:127905792-127905814 TGAAGCCCAGGGTAGATGGAAGG + Intronic
1033602550 7:142898644-142898666 GCCATCCCAGGGCAGAGAGAGGG + Intergenic
1034092718 7:148378946-148378968 TTCACCCCAGAACAGAGGGAAGG + Intronic
1034407461 7:150914670-150914692 TCCACCACAGCCCAGATGGATGG - Intergenic
1035694282 8:1583239-1583261 CCCAACCCATGGCAGATGGGAGG - Intronic
1035938409 8:3868406-3868428 TCCACACAAGGGCAGCTGGGGGG + Intronic
1036357416 8:8055233-8055255 TACACCCCAGGGCAGCTATAAGG - Intergenic
1038130677 8:24727745-24727767 CCCATCCCAGAGCAGATGAAAGG + Intergenic
1038269736 8:26065494-26065516 TGCAGGCCAGGGCAGATGGCAGG - Intergenic
1038534951 8:28347227-28347249 TCCATCCCAGGACAGGTGGCTGG + Exonic
1040799553 8:51325641-51325663 ACCACCCCAGTGAAGAGGGAGGG + Intronic
1042771316 8:72385738-72385760 TGAACGCCAGGTCAGATGGAGGG + Intergenic
1047762866 8:127967123-127967145 CCCACCCCAGGGCTGATTGCAGG + Intergenic
1049221808 8:141431953-141431975 TCCCTCCCTGGGCTGATGGATGG - Exonic
1049554448 8:143275095-143275117 CCCAGCCCAAGGCAGGTGGAGGG - Intronic
1049618663 8:143588093-143588115 TGAACACCAGGGCAGGTGGAAGG + Intronic
1056237968 9:84614874-84614896 TCCTTGCCAGGGCAGATGGGAGG - Intergenic
1059734833 9:117090733-117090755 TCCACCCAGGGCCACATGGAAGG + Intronic
1059755317 9:117288290-117288312 TCCACCCCAGGAGGCATGGATGG + Intronic
1061499320 9:130993174-130993196 TCCTCCCCTGGGCAGGTGGCAGG - Intergenic
1061887431 9:133598943-133598965 GAGAGCCCAGGGCAGATGGAGGG + Intergenic
1061939134 9:133874722-133874744 TCCACCTCTGGGAAGAGGGAAGG - Intronic
1062053004 9:134457093-134457115 TCCACCCCACGGGACATAGAGGG - Intergenic
1062668055 9:137688473-137688495 TCCTCCTCAGAGCACATGGAGGG + Intronic
1188246462 X:27841038-27841060 TGCCTCCCAGGGCTGATGGAAGG - Intergenic
1190266218 X:48828657-48828679 TCCTCCCCATGACAGAGGGAGGG - Intergenic
1192183616 X:68931247-68931269 TCCACCCCAGGGCAGAACACGGG - Intergenic
1192221106 X:69197872-69197894 TCCACCCCACTGCAGATGCCTGG + Intergenic
1194554085 X:95336677-95336699 TTCTCCACAGGGCAGAGGGATGG + Intergenic
1195666503 X:107436277-107436299 TCCAGGCTAGGGCAGAAGGATGG - Intergenic
1200802563 Y:7399776-7399798 TCCACCCCAGAGGAGATGTGTGG + Intergenic