ID: 1139431736

View in Genome Browser
Species Human (GRCh38)
Location 16:66914359-66914381
Sequence GACCTACCAGCTGTTGGTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139431736_1139431746 19 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431746 16:66914401-66914423 GGCTGGTGCTCCCTAGAACAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
1139431736_1139431743 2 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431743 16:66914384-66914406 CTCCAGGGCGTGGTCAAGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 201
1139431736_1139431741 -2 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431741 16:66914380-66914402 TCCTCTCCAGGGCGTGGTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 170
1139431736_1139431745 18 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431745 16:66914400-66914422 AGGCTGGTGCTCCCTAGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 110
1139431736_1139431747 22 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431747 16:66914404-66914426 TGGTGCTCCCTAGAACAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 109
1139431736_1139431748 26 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431748 16:66914408-66914430 GCTCCCTAGAACAGGGAGGATGG 0: 1
1: 0
2: 0
3: 21
4: 231
1139431736_1139431740 -8 Left 1139431736 16:66914359-66914381 CCTGTACCAACAGCTGGTAGGTC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1139431740 16:66914374-66914396 GGTAGGTCCTCTCCAGGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139431736 Original CRISPR GACCTACCAGCTGTTGGTAC AGG (reversed) Exonic
904809779 1:33155851-33155873 GACTTATCAGGTGTTGGGACTGG - Intronic
908964697 1:69745327-69745349 AACCTACCATCTGTTGGCACTGG + Intronic
912762844 1:112384433-112384455 GACCTACCAGCTGTGTGATCTGG - Intergenic
914093420 1:144524331-144524353 GACCAACCAGCTGTGGGAGCGGG + Intergenic
914519436 1:148402398-148402420 GACCTACCCGCTGTCGGAGCCGG - Intergenic
920044663 1:203125613-203125635 GACTTACCAGCTGTTGGTGTAGG + Intronic
922124590 1:222710483-222710505 GACCTAGCAGCTGTTGACACTGG - Intronic
922630057 1:227097801-227097823 GACCTACCAGCACTTGGGAGGGG - Intronic
1062972981 10:1662440-1662462 GACCTGCCTGCTCTTGGTTCCGG + Intronic
1072197248 10:93126689-93126711 AACCTACCAATTGTTGGAACTGG - Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1079031849 11:16992018-16992040 GCCTTACCAGATGCTGGTACTGG + Intronic
1083989759 11:66239676-66239698 GACCTCCCAGGTGTTGTTATGGG + Intronic
1084456834 11:69272911-69272933 GACCTCCCTGCTGTTGGCACTGG - Intergenic
1086662709 11:89440984-89441006 TACCTACAAGCTGGTGGCACTGG + Intronic
1089928384 11:122283144-122283166 CACCTTCCAGCTGATGGAACTGG + Intergenic
1092200823 12:6581642-6581664 GACTTACCAGCAGGTGGGACAGG + Exonic
1093283828 12:17231988-17232010 GACTTTCCAGCTGCTGGTAGTGG + Intergenic
1094759005 12:33507178-33507200 AACCTACCTACTGTTGGAACTGG - Intergenic
1095273308 12:40248767-40248789 GACCGAACAGCTGTTGGCAGTGG + Intronic
1100489729 12:95067815-95067837 GACCTCCCAAGTGTTGGTATTGG + Intronic
1108461108 13:50668171-50668193 GACCTCCAAGCTGTTCTTACTGG - Intronic
1109408677 13:61936102-61936124 GACCTACCAGCACTTGGGAGGGG + Intergenic
1112320067 13:98397710-98397732 GGCTTCCCAGCTGTTTGTACTGG + Intronic
1113681822 13:112249868-112249890 GACCTGTGAGCTGGTGGTACAGG + Intergenic
1113820241 13:113208592-113208614 GACCCACCTGCTGCAGGTACTGG + Exonic
1116053807 14:39838654-39838676 CACCTACCAGCTGTAGGTATTGG - Intergenic
1120185371 14:81388397-81388419 TTCCTACCAGCTGTTGCTCCTGG + Intronic
1128956364 15:71950086-71950108 GAACTACCAGCTTTAGGTAGTGG - Intronic
1130845025 15:87736055-87736077 TACCTACCTGCTGTGGGTCCTGG + Intergenic
1138680250 16:58678804-58678826 GACCTACCAGGAGGTGGTATGGG - Exonic
1139431736 16:66914359-66914381 GACCTACCAGCTGTTGGTACAGG - Exonic
1141680084 16:85538719-85538741 GACCAACCAGCTCTTGGAAAAGG + Intergenic
1156066238 18:33146850-33146872 GACTTTCCATCTGTTGTTACTGG - Intronic
1156458764 18:37309468-37309490 GCCCTAGCAGCTGCTGCTACAGG + Intronic
1158927200 18:62279764-62279786 GACCAATCAGCTGTTGGTGAAGG + Intronic
1160707532 19:536466-536488 GACCTGCCAGCTGGCGGTCCTGG + Intronic
1161062152 19:2220516-2220538 GGCCTCCCAGCTGTGAGTACAGG - Intronic
1166872968 19:45882160-45882182 CACCTACCAGCTGTTCTTAAAGG + Intergenic
927848428 2:26484200-26484222 GACCCAGCAGCTGCTGGTTCTGG + Intronic
929810252 2:45183601-45183623 GACCTTCCAGATGTTGCTAGGGG + Intergenic
931091068 2:58887002-58887024 GAGCTACCATCTGTTCTTACTGG - Intergenic
937917880 2:127107680-127107702 GACCAAGCACCGGTTGGTACTGG - Intergenic
938025622 2:127945449-127945471 CACCTACCAGCTGTAGTAACTGG + Exonic
1170320839 20:15096165-15096187 GATCTACTAGCTGCTGCTACTGG - Intronic
1181500146 22:23311351-23311373 GACCTCCCAGCCGGGGGTACAGG + Intronic
1182861307 22:33561722-33561744 AATCTTCCAGCTGTTGGTGCAGG + Intronic
1183574480 22:38678769-38678791 GAACTAAAAGCTGTTGGCACTGG + Intergenic
951062995 3:18232356-18232378 GAAATAGCAGCTGTTTGTACAGG - Intronic
955644333 3:61120595-61120617 GACCTACCAGTGGTTGGTTGGGG - Intronic
959454561 3:106542616-106542638 GAAATACCAGCTGTTTGTCCTGG + Intergenic
961307267 3:125967507-125967529 GGGCTACCAGGTGTTGGTACAGG - Intergenic
964326286 3:155549842-155549864 GACCTGTCATCTGTTGATACAGG - Exonic
966751710 3:183328338-183328360 GACCTACCAGCTGTGGATTAGGG - Intronic
969168688 4:5340967-5340989 GACCTGCCAGCTGTGTGTCCTGG - Intronic
977543070 4:98341572-98341594 GCCCCACCATCTGCTGGTACTGG - Intronic
977638113 4:99324042-99324064 GACATTCCAGATGTTGCTACAGG - Intergenic
978405785 4:108377382-108377404 GGCATATCAGCTGTTGGCACTGG - Intergenic
979401463 4:120254856-120254878 GACTTTGCAGCTGTTGGTACCGG + Intergenic
982078188 4:151760382-151760404 TACCTACAAGCTCTTGGTAGTGG - Intronic
990174339 5:53090607-53090629 GACCTACCTGCAGTGGGAACCGG + Exonic
1003661719 6:8068445-8068467 GAACTAGCAGCATTTGGTACAGG - Intronic
1004099502 6:12594354-12594376 GACCTCCCAGCTCTTGGGAGGGG + Intergenic
1008181756 6:48339640-48339662 GACCAGCAAGCTGTTGGTTCAGG - Intergenic
1012417013 6:99022643-99022665 GACCACCCTGCTATTGGTACAGG + Intergenic
1012992144 6:105936938-105936960 GAGCTACCAACTGGTGGAACTGG - Intergenic
1027584768 7:80044560-80044582 GATCTACCAGCAGTTTGCACTGG - Intergenic
1029445931 7:100612809-100612831 GACCCACCAGCTCCTGGTCCTGG - Exonic
1038364174 8:26914403-26914425 GAGCTACCAGATGTTGGAAGAGG + Intergenic
1039339062 8:36626913-36626935 GAAATACCAGCTATTGGTATTGG - Intergenic
1042102572 8:65289264-65289286 GACTTACCAGCTCTGGGAACAGG + Intergenic
1048554845 8:135465077-135465099 TACCTACCAGATGTTGCCACTGG - Intronic
1049528013 8:143138852-143138874 TAACTACGAGCTGTTGGTGCTGG - Intergenic