ID: 1139432253 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:66917546-66917568 |
Sequence | AAAGAGAAACAGCAAGAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2254 | |||
Summary | {0: 1, 1: 0, 2: 27, 3: 250, 4: 1976} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1139432249_1139432253 | 17 | Left | 1139432249 | 16:66917506-66917528 | CCTGTGTAACGTGTACATACTCT | 0: 1 1: 0 2: 0 3: 3 4: 48 |
||
Right | 1139432253 | 16:66917546-66917568 | AAAGAGAAACAGCAAGAGGAAGG | 0: 1 1: 0 2: 27 3: 250 4: 1976 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1139432253 | Original CRISPR | AAAGAGAAACAGCAAGAGGA AGG | Intronic | ||
Too many off-targets to display for this crispr |