ID: 1139432253

View in Genome Browser
Species Human (GRCh38)
Location 16:66917546-66917568
Sequence AAAGAGAAACAGCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2254
Summary {0: 1, 1: 0, 2: 27, 3: 250, 4: 1976}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139432249_1139432253 17 Left 1139432249 16:66917506-66917528 CCTGTGTAACGTGTACATACTCT 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG 0: 1
1: 0
2: 27
3: 250
4: 1976

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139432253 Original CRISPR AAAGAGAAACAGCAAGAGGA AGG Intronic
Too many off-targets to display for this crispr