ID: 1139432662

View in Genome Browser
Species Human (GRCh38)
Location 16:66919394-66919416
Sequence GTATTAATAGAGATAGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139432662_1139432665 23 Left 1139432662 16:66919394-66919416 CCATGTGCTATCTCTATTAATAC No data
Right 1139432665 16:66919440-66919462 GTCTGCCTCTTCCATTAGATTGG No data
1139432662_1139432666 24 Left 1139432662 16:66919394-66919416 CCATGTGCTATCTCTATTAATAC No data
Right 1139432666 16:66919441-66919463 TCTGCCTCTTCCATTAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139432662 Original CRISPR GTATTAATAGAGATAGCACA TGG (reversed) Intergenic
No off target data available for this crispr