ID: 1139433157

View in Genome Browser
Species Human (GRCh38)
Location 16:66921953-66921975
Sequence TGCCCGGCTGGCAGCTCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139433152_1139433157 -2 Left 1139433152 16:66921932-66921954 CCATGACCATGAGGTTGGGGGTG 0: 1
1: 0
2: 3
3: 23
4: 153
Right 1139433157 16:66921953-66921975 TGCCCGGCTGGCAGCTCCGAGGG 0: 1
1: 0
2: 2
3: 9
4: 126
1139433146_1139433157 28 Left 1139433146 16:66921902-66921924 CCACTTCGCAGGGCAGCACTGTC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1139433157 16:66921953-66921975 TGCCCGGCTGGCAGCTCCGAGGG 0: 1
1: 0
2: 2
3: 9
4: 126
1139433154_1139433157 -8 Left 1139433154 16:66921938-66921960 CCATGAGGTTGGGGGTGCCCGGC 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1139433157 16:66921953-66921975 TGCCCGGCTGGCAGCTCCGAGGG 0: 1
1: 0
2: 2
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139433157 Original CRISPR TGCCCGGCTGGCAGCTCCGA GGG Exonic