ID: 1139433263

View in Genome Browser
Species Human (GRCh38)
Location 16:66922487-66922509
Sequence GCTCCTGTACTGAGGGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139433253_1139433263 2 Left 1139433253 16:66922462-66922484 CCTCCCCGAAAACACAGAGACCC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 89
1139433252_1139433263 23 Left 1139433252 16:66922441-66922463 CCACTCGAGAATTTGCAAGGTCC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 89
1139433256_1139433263 -3 Left 1139433256 16:66922467-66922489 CCGAAAACACAGAGACCCCAGCT 0: 1
1: 0
2: 1
3: 42
4: 314
Right 1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 89
1139433254_1139433263 -1 Left 1139433254 16:66922465-66922487 CCCCGAAAACACAGAGACCCCAG 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 89
1139433255_1139433263 -2 Left 1139433255 16:66922466-66922488 CCCGAAAACACAGAGACCCCAGC 0: 1
1: 0
2: 4
3: 43
4: 328
Right 1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139433263 Original CRISPR GCTCCTGTACTGAGGGTACT GGG Intronic
901919946 1:12528666-12528688 ACTCCTGTGCTGAGCGCACTGGG - Intergenic
908439614 1:64140795-64140817 GCTCCTCTACTGATGGCATTTGG - Intronic
913185015 1:116363022-116363044 GCCCCTGTCCCTAGGGTACTGGG + Intergenic
915610727 1:156990071-156990093 GCTCCTGAACTGAGGCAATTGGG - Intronic
920453687 1:206080778-206080800 GCTCCTGCTCAGAGGCTACTGGG - Intronic
921311579 1:213849352-213849374 GCTCCTATACTTAGGCTACTAGG + Intergenic
1063852689 10:10210870-10210892 GCTCTTGTAGTGTGGGTATTGGG + Intergenic
1066050522 10:31631418-31631440 GATCCTATACCCAGGGTACTAGG + Intergenic
1072191827 10:93082113-93082135 GCTTCTGTGCTGAGGGTGCGTGG - Intergenic
1075858969 10:125657329-125657351 GCTCCAGGACTGAGGGGACTGGG + Intronic
1077508037 11:2941153-2941175 GCACCTGTTCTGAGGGTTTTGGG + Intergenic
1078354726 11:10625220-10625242 CCTCCTGCTCTGAGGGTGCTGGG + Intronic
1085299460 11:75449845-75449867 GCTCTTGTTGTGAGGGTCCTGGG + Intronic
1091122271 11:133066090-133066112 GCTGCTGGCCTGAGGGTCCTGGG - Intronic
1094373873 12:29769396-29769418 GCTCCTGTATTGAGGATGCTGGG - Intronic
1095878250 12:47105165-47105187 GCTCCTATACAGAGGGGAGTGGG + Intronic
1098976160 12:76904157-76904179 GCTAGTATACTGTGGGTACTTGG + Intergenic
1103299461 12:119916929-119916951 GCTTCTGACCTGAGGGTACTTGG + Intergenic
1106559420 13:30835550-30835572 GCTCCTGTCTTGAGCGTCCTTGG + Intergenic
1108368835 13:49746772-49746794 TTTCATTTACTGAGGGTACTAGG - Intronic
1111260115 13:85726478-85726500 GGTCCTATACTGAGCGTGCTGGG - Intergenic
1111736062 13:92140748-92140770 GCCCCTGTAATGAGGGAGCTGGG + Intronic
1112850840 13:103704762-103704784 GCACATGTAGAGAGGGTACTGGG + Intergenic
1116175132 14:41459584-41459606 GCTGCAGTACTGAGGATCCTTGG - Intergenic
1121740366 14:96247744-96247766 GCCCCTGTACTGTTGGTGCTGGG - Intronic
1122151602 14:99728883-99728905 GGTGCTGTACTGTGGGGACTAGG - Intergenic
1122748789 14:103917828-103917850 GCTCCTATAAAGCGGGTACTCGG + Intronic
1123819358 15:24012198-24012220 GCTCCTGTTCTTTGGGTTCTGGG + Intergenic
1124089672 15:26586546-26586568 GCTACTGTACTTGGTGTACTTGG - Intronic
1124533860 15:30527310-30527332 GCTCCTGTCCTGGGGATACTGGG - Intergenic
1124764788 15:32480299-32480321 GCTCCTGTCCTGGGGATACTGGG + Intergenic
1124812601 15:32956114-32956136 GTTCCTGTTCTGGGGGTTCTAGG + Intronic
1126109140 15:45165677-45165699 GCTCCTTTACTCAGGACACTGGG - Intergenic
1128309050 15:66619293-66619315 GCTCCTGTAGTGATGGGGCTCGG + Intronic
1132543752 16:523626-523648 GCACCTGCACTGAGGGTTCAAGG - Intergenic
1138007663 16:53353430-53353452 GCTCCTGTCCTGGGGATATTGGG + Intergenic
1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG + Intronic
1141077280 16:81018756-81018778 TCTCCTGCACTGAGGGAATTTGG + Intronic
1141277861 16:82604437-82604459 GCTTCTGTTCTGAGGGTCCATGG + Intergenic
1142213960 16:88821889-88821911 GCTCCTGGCCTGGGGGTCCTGGG - Intronic
1146175057 17:30660687-30660709 GCTTCTGTAAGGAGGGAACTGGG + Intergenic
1146348511 17:32076711-32076733 GCTTCTGTAAGGAGGGAACTGGG + Intergenic
1148000469 17:44384577-44384599 GCCCTTGTCCTCAGGGTACTCGG - Exonic
1153351420 18:4084535-4084557 GCTCCTGTCCTGTGGGTATAGGG - Intronic
1153945969 18:10017643-10017665 GCTTCTGTTCTGTGGGTACACGG + Intergenic
1157735677 18:50046632-50046654 GCTACTGTAGTGAGGGTAAGTGG - Intronic
1159249944 18:65862857-65862879 GCTCCTGTACTGAGGCCAGCAGG - Exonic
1161626284 19:5328864-5328886 GGTCCTGCTCTGAGAGTACTCGG - Intronic
1166071480 19:40390491-40390513 GATTCTGTTCTGAGGGCACTGGG + Intergenic
933766559 2:85713194-85713216 GCTGCTCTACTAAGGGTGCTGGG - Intergenic
942406153 2:175657888-175657910 GCATATGTTCTGAGGGTACTTGG + Intergenic
1168855483 20:1004742-1004764 ACTCCAGTACTGGGGGTAGTGGG - Intergenic
1169031194 20:2408473-2408495 GCTCCTAGACTGAGAGTTCTAGG + Intronic
1173156154 20:40611542-40611564 GCTGCTTTACTAAGTGTACTGGG + Intergenic
1175321972 20:58094604-58094626 GCTCCTAGGCTGAGGGTAGTGGG - Intergenic
1176386425 21:6140453-6140475 GCTCCAGTACTGAGGATTCCAGG - Intergenic
1179409353 21:41150193-41150215 GCACCTGTCCTGAAGGTGCTTGG + Intergenic
1179737048 21:43397799-43397821 GCTCCAGTACTGAGGATTCCAGG + Intergenic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1181738965 22:24904820-24904842 ACTCCTTTACTGGGGGTACAAGG - Intronic
1183003465 22:34880614-34880636 GCTCCAGGACTGTGGGTATTAGG - Intergenic
1183479935 22:38057868-38057890 GCTCCTATACTGCTGGAACTTGG - Intronic
950710221 3:14808759-14808781 GCTCCTGCCCTGGGGGTTCTAGG + Intergenic
955318685 3:57959173-57959195 GTTCCTGGACTGTGGGTTCTAGG + Intergenic
955704712 3:61716018-61716040 TCTCCTGTGGTGAGGGTGCTGGG + Intronic
956643277 3:71434413-71434435 ACTCCTGTATTGAGGGAAGTTGG - Intronic
968536317 4:1132405-1132427 GCTCCTATTCTGAGGGTAACAGG + Intergenic
968903122 4:3440378-3440400 CACCCTGTACCGAGGGTACTTGG - Intergenic
971975381 4:33679323-33679345 TCTAGTGTACTGATGGTACTAGG - Intergenic
975263012 4:72327602-72327624 GCTCGTGTACTAATTGTACTTGG - Intronic
981474588 4:145175990-145176012 GCTCCTGTAATCCGGCTACTCGG - Intronic
984742452 4:183178824-183178846 GCTCCTGCAGTAAGGGGACTTGG - Intronic
985155111 4:186979437-186979459 CCTCTTTTACTCAGGGTACTTGG + Intergenic
985383515 4:189420643-189420665 GTTCTTGTAATGAGGGTGCTAGG - Intergenic
992124554 5:73626723-73626745 GCTCCGGGACTGAGGGTGCTTGG + Intronic
992729716 5:79650657-79650679 GTTTCTGTACTGAGGATACTGGG + Intronic
993887772 5:93436562-93436584 ACTGCTGTATTGAGGGCACTAGG + Intergenic
997172458 5:131737204-131737226 GGTCCTGTAATGAGGGGACAAGG - Intronic
998001561 5:138629976-138629998 GATCCTGCACTGAGGGGAGTTGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1001648323 5:173298289-173298311 ACTCCTGGACTGGGGGTCCTTGG - Intergenic
1006945064 6:37779388-37779410 GCTCACCCACTGAGGGTACTGGG - Intergenic
1015181654 6:130366750-130366772 GCTCCAGTACTCCGGGTTCTTGG - Intronic
1018687577 6:166315913-166315935 GCAGCAGGACTGAGGGTACTGGG + Intergenic
1030492796 7:110258977-110258999 CCTCATGCTCTGAGGGTACTTGG - Intergenic
1033434920 7:141324503-141324525 GCTCCTGGTGTGAGGGTAGTGGG + Intronic
1034049635 7:147968904-147968926 TCTCCTCTACTCAGGGCACTGGG - Intronic
1039722044 8:40174619-40174641 GCCCCTTTACAGAGGGAACTTGG + Intergenic
1040852278 8:51913348-51913370 GCTCTAGTAATGAGGGAACTGGG - Intergenic
1043454277 8:80398410-80398432 GCTTCTGCACTGAGGGTCCATGG + Intergenic
1047274389 8:123394929-123394951 GCTACTCTACTGAGGGGAATGGG - Intronic
1047771133 8:128031044-128031066 GCTCCTGGACTGAGGGCAGCAGG - Intergenic
1051842664 9:21415976-21415998 CATCCTGTACTGATGGCACTAGG + Intronic
1052170148 9:25384380-25384402 GATCCTCTACTGAGAGTACCAGG - Intergenic
1056830905 9:89916559-89916581 GTTCCTGTACTAAGGCTGCTTGG + Intergenic
1057194703 9:93110554-93110576 GTTCCGGAACTGAGGGTACAAGG - Exonic
1061623672 9:131827850-131827872 GCTCCTGGGCTGAGTGTCCTGGG - Intergenic
1185470503 X:378930-378952 GCTCCTGCCCTGAGGGTTCTAGG + Intronic
1186156745 X:6733557-6733579 GCTGCTGTGCTGAGGGTATTTGG + Intergenic
1186889684 X:13947953-13947975 GCTCCTTTAATGAAGGAACTGGG + Intergenic