ID: 1139434371

View in Genome Browser
Species Human (GRCh38)
Location 16:66927478-66927500
Sequence GAACCACTCCTAGGTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139434368_1139434371 1 Left 1139434368 16:66927454-66927476 CCCAGGAGGAATAAACTGAGGCT No data
Right 1139434371 16:66927478-66927500 GAACCACTCCTAGGTCCGCCCGG No data
1139434362_1139434371 28 Left 1139434362 16:66927427-66927449 CCCAGCTCTCTGGGCTGAGCATG No data
Right 1139434371 16:66927478-66927500 GAACCACTCCTAGGTCCGCCCGG No data
1139434369_1139434371 0 Left 1139434369 16:66927455-66927477 CCAGGAGGAATAAACTGAGGCTA No data
Right 1139434371 16:66927478-66927500 GAACCACTCCTAGGTCCGCCCGG No data
1139434363_1139434371 27 Left 1139434363 16:66927428-66927450 CCAGCTCTCTGGGCTGAGCATGG No data
Right 1139434371 16:66927478-66927500 GAACCACTCCTAGGTCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139434371 Original CRISPR GAACCACTCCTAGGTCCGCC CGG Intergenic
No off target data available for this crispr