ID: 1139435150

View in Genome Browser
Species Human (GRCh38)
Location 16:66932617-66932639
Sequence GTTATAGCCTAGACCGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139435150_1139435152 -3 Left 1139435150 16:66932617-66932639 CCAGCTTCGGTCTAGGCTATAAC 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1139435152 16:66932637-66932659 AACCCATACTGAGGAGTCTCTGG 0: 1
1: 0
2: 2
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139435150 Original CRISPR GTTATAGCCTAGACCGAAGC TGG (reversed) Intronic
1067237940 10:44467346-44467368 GTTAGAGCATAGTCAGAAGCAGG + Intergenic
1075246509 10:120827199-120827221 TTTAGAGCCTAGACTGAAGGTGG + Intergenic
1081570817 11:44289763-44289785 CTTAGAGCCCAGACTGAAGCTGG - Intronic
1088416609 11:109596402-109596424 TTTAGAGCCTAGAGCAAAGCTGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1100001385 12:89840483-89840505 GTTATAGCCTAGGGAGGAGCTGG + Intergenic
1101477879 12:105067768-105067790 GTTATAGCCTAGATGGAGGTGGG - Intronic
1102984898 12:117270104-117270126 GTTACAGCCAAGGCAGAAGCAGG + Intronic
1111264961 13:85797135-85797157 TATATAGCCAAAACCGAAGCAGG - Intronic
1117210291 14:53490569-53490591 GTAAGAGTGTAGACCGAAGCTGG + Intergenic
1126032304 15:44511344-44511366 GTTATAGCTTTGACCTAATCTGG + Intronic
1126672556 15:51129525-51129547 GAAATAGCCTAAACTGAAGCTGG - Intergenic
1137844549 16:51674510-51674532 GGTACAGCATAGACCGAAGCTGG - Intergenic
1139435150 16:66932617-66932639 GTTATAGCCTAGACCGAAGCTGG - Intronic
1143870668 17:9955613-9955635 CTAAGAGCCTAGACTGAAGCCGG - Intronic
1143934324 17:10466546-10466568 GTGACAGCCAAGACCGAAGCTGG - Exonic
1143938808 17:10516443-10516465 GTGACAGCTAAGACCGAAGCTGG - Exonic
1153485603 18:5594597-5594619 GATATTGCCTAGTCTGAAGCTGG - Intronic
1183195255 22:36349242-36349264 CTTATAGCCAGGACCTAAGCGGG + Exonic
1003181095 6:3792351-3792373 GTTATAGCCTAGTCCACAGTAGG - Intergenic
1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG + Intergenic
1026733402 7:72931313-72931335 TTTTTAGCCTATACCGAAGTTGG + Intronic
1032158044 7:129486083-129486105 GTTGTAGCCAAGACTAAAGCAGG - Exonic
1045413233 8:101941086-101941108 CTTATAGCCTAGACTGCAGAGGG - Intronic
1047142127 8:122153094-122153116 GTTATAGCCAAGATTGAGGCAGG - Intergenic
1047734122 8:127750898-127750920 TTTGTAGCCTAGATCGGAGCAGG - Intergenic
1197040402 X:121929769-121929791 CTTTTAGCCAAGACTGAAGCTGG - Intergenic