ID: 1139436357

View in Genome Browser
Species Human (GRCh38)
Location 16:66938876-66938898
Sequence TAACCCGTAAGGCCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139436357_1139436362 -9 Left 1139436357 16:66938876-66938898 CCTGTCCCAGGCCTTACGGGTTA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1139436362 16:66938890-66938912 TACGGGTTACAGGAATATAGTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1139436357_1139436363 17 Left 1139436357 16:66938876-66938898 CCTGTCCCAGGCCTTACGGGTTA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1139436363 16:66938916-66938938 ATGTCAACACATGCAGCCAATGG 0: 1
1: 0
2: 0
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139436357 Original CRISPR TAACCCGTAAGGCCTGGGAC AGG (reversed) Intronic
904841284 1:33373481-33373503 TAAGCAGTAAGGCCAGGGAATGG - Intronic
906417046 1:45628462-45628484 TGACCCATAAGCCCTGGGAAAGG + Intronic
906447284 1:45913351-45913373 TAACCCAGAAGGCATGGGCCAGG - Intronic
910553047 1:88498296-88498318 TCAGCAGTAAGCCCTGGGACAGG - Intergenic
918931795 1:190864300-190864322 TAAGTCATGAGGCCTGGGACAGG - Intergenic
1063035646 10:2284282-2284304 TGTCCCGGCAGGCCTGGGACCGG + Intergenic
1067058605 10:43066382-43066404 TGACCAGTAAGGCCAGGGCCAGG + Intergenic
1068474112 10:57503468-57503490 AAATACGTAAGGCCTGGGAAAGG - Intergenic
1068971806 10:62966732-62966754 TAACCTGTAATGCCTAGCACAGG + Intergenic
1070785169 10:79158482-79158504 TAACCCTTGAGGCCAGGGCCAGG + Intronic
1072553715 10:96498308-96498330 GAACCCTGAAGGCCTGGGAGGGG - Intronic
1073156967 10:101354604-101354626 TTACCGGTAAGGCCCGGGAGAGG + Intronic
1074447318 10:113531118-113531140 TAGCCCGAAAAGCCTGGGAGAGG + Intergenic
1079326768 11:19499735-19499757 TAACCTGCCAGGCCTGGGCCAGG - Intronic
1079765740 11:24389709-24389731 TGACCCGTACAGCCTGGGGCAGG - Intergenic
1083571003 11:63762478-63762500 CAACCCGCAGGGCCTGGGGCCGG - Exonic
1083574516 11:63780219-63780241 TAACCAGTAAGTCCAGGGTCAGG - Intergenic
1084352671 11:68614668-68614690 TCAGCAGTAAGCCCTGGGACAGG + Exonic
1089811762 11:121137932-121137954 TAACCCACAAGGCCAGTGACGGG - Exonic
1125499612 15:40231243-40231265 TCACCCCTAAGGGCTGGGGCTGG + Intergenic
1125835979 15:42751833-42751855 TAGGCTGTAAGGCCTGGGAAAGG + Intronic
1127960642 15:63887894-63887916 AAAGCCACAAGGCCTGGGACAGG + Intergenic
1139436357 16:66938876-66938898 TAACCCGTAAGGCCTGGGACAGG - Intronic
1146267018 17:31459582-31459604 TAACCCATCAGGCGTGGGAGTGG - Intronic
1149380383 17:56087632-56087654 TAACCCTCAAGGACTGGGAGGGG - Intergenic
1153834276 18:8950161-8950183 TCACCTGTAAGCCCTGGGAGGGG + Intergenic
1154978968 18:21486579-21486601 TAATCCCTAAGGCCAGGGACTGG - Intronic
1156871522 18:41951298-41951320 GAACCCCCAAGGCCTGGGTCGGG - Intergenic
1160137494 18:76285017-76285039 TTACCCGTTTGGCCTGGGGCAGG - Intergenic
925793718 2:7520438-7520460 AAACCCGTAATTCCTGGGAAAGG - Intergenic
927909375 2:26885722-26885744 GAACCTGAATGGCCTGGGACTGG - Intronic
929027565 2:37619452-37619474 TACACCCTTAGGCCTGGGACAGG - Intergenic
938770723 2:134498730-134498752 TAGCCAGAAAGGCCAGGGACAGG + Intronic
942133735 2:172905293-172905315 TAGCCTGCAAGGCCTGGGAGGGG + Intronic
944656755 2:201883294-201883316 TAAAGCATAAAGCCTGGGACTGG + Intronic
1169265236 20:4163342-4163364 TAAGCTGTAGGGCCTGGGCCAGG + Intronic
1173243582 20:41318341-41318363 TAACCTGTAATGCCTGGGATGGG + Intergenic
1182096361 22:27628641-27628663 AAACCCGAAATGCCTGAGACTGG - Intergenic
1183327598 22:37202914-37202936 GAACCCGCAGGGCCTGGGGCAGG - Intergenic
1183919387 22:41152462-41152484 TAACCTGGAAGCCCTGGGCCTGG + Intronic
949661534 3:6284303-6284325 GATCCCATAAGGCCTGGGAATGG + Intergenic
949919016 3:8986979-8987001 TAACCCAAGAGCCCTGGGACAGG + Intronic
950096370 3:10333153-10333175 TGACCACAAAGGCCTGGGACAGG - Intronic
952005162 3:28835339-28835361 TCACCTGTGAAGCCTGGGACCGG + Intergenic
953880466 3:46688697-46688719 TCACCTGTGAGGCCTTGGACAGG - Intronic
962799752 3:138880155-138880177 TAACCTGTAAGGCAGGGGAATGG - Intergenic
970027967 4:11643928-11643950 TAACCCGTACAGCATGGTACTGG - Intergenic
970219517 4:13796494-13796516 CAACTAGTAAGGCCTGGGAGGGG + Intergenic
970460507 4:16270253-16270275 AAACCCGCAAGGCCTGGCTCCGG + Intergenic
970473292 4:16397782-16397804 TGACCCTTCAGGCCAGGGACAGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1004227438 6:13799109-13799131 TAACTGGGAAGTCCTGGGACAGG - Intronic
1004273790 6:14217887-14217909 TTACCAGTAATGCCTGGGAAGGG + Intergenic
1011202120 6:84848024-84848046 TAAGCCTTAATGCCTGGGAAAGG - Intergenic
1011430884 6:87285388-87285410 TAAACCTTAAGGACTGGGAAGGG - Intronic
1014335507 6:120129167-120129189 TAAAGCAAAAGGCCTGGGACTGG - Intergenic
1020066253 7:5190488-5190510 CAACACGTAAGGCCGGGGTCGGG + Exonic
1020182718 7:5934695-5934717 TAACCAGTAAGGCATGGAGCTGG - Intronic
1020300194 7:6790062-6790084 TAACCAGTAAGGCATGGAGCTGG + Intronic
1022519879 7:30999266-30999288 TGACCCCTAAGACCTGGGTCCGG - Intergenic
1023043698 7:36193973-36193995 GAACCGGCAAGTCCTGGGACTGG - Intronic
1030541975 7:110842452-110842474 CAACTCGGAAGGCCTGGGGCTGG + Intronic
1032790183 7:135237012-135237034 AAACCAGTGTGGCCTGGGACTGG + Intronic
1038931036 8:32193900-32193922 TTAGCAGGAAGGCCTGGGACAGG + Intronic
1049005270 8:139851467-139851489 CATCCCGGAAGGCATGGGACCGG + Intronic
1053876048 9:42547708-42547730 TGCCCAGTAAGGCCTGGGAAGGG - Intergenic
1053896607 9:42746923-42746945 TGCCCAGTAAGGCCTGGGAAGGG + Intergenic
1054235650 9:62554014-62554036 TGCCCAGTAAGGCCTGGGAAGGG + Intergenic
1058074955 9:100641351-100641373 TAACCAGCAGGGCCAGGGACTGG - Intergenic
1060662150 9:125410853-125410875 TGACCCAGAAGGCCTGGGTCTGG + Intergenic
1187508598 X:19897511-19897533 TGACCCGGAAGGCCTGGGGCGGG - Intergenic
1189534383 X:41922684-41922706 CACCCCGTAAGGCGTGGGGCCGG - Intronic