ID: 1139441153

View in Genome Browser
Species Human (GRCh38)
Location 16:66967937-66967959
Sequence GAGGGAGACCTGACTATACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139441153_1139441154 -8 Left 1139441153 16:66967937-66967959 CCGTGTATAGTCAGGTCTCCCTC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1139441154 16:66967952-66967974 TCTCCCTCTGTTGCCCAAGCTGG 0: 64
1: 3702
2: 49999
3: 144688
4: 216791
1139441153_1139441159 6 Left 1139441153 16:66967937-66967959 CCGTGTATAGTCAGGTCTCCCTC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1139441159 16:66967966-66967988 CCAAGCTGGTCTAGAGCACCTGG 0: 1
1: 3
2: 153
3: 4006
4: 38985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139441153 Original CRISPR GAGGGAGACCTGACTATACA CGG (reversed) Intronic
901741694 1:11345974-11345996 GAGGGAGTCCTGACACTGCAAGG - Intergenic
901893751 1:12290997-12291019 GAGGGAGACCTGGCCTTACAGGG + Exonic
902036981 1:13464964-13464986 GAGGGCGGCCTGACCAGACATGG + Intergenic
902049266 1:13549008-13549030 TAGGGAGACCTGAGAAGACAAGG + Intergenic
902542830 1:17166632-17166654 TAGGGAGACCTGACTTCAGAGGG - Intergenic
903709076 1:25308600-25308622 CAAGGAGACATCACTATACATGG + Intronic
904928727 1:34069192-34069214 TAGGGAGGCCTAAATATACAGGG + Intronic
906179700 1:43807628-43807650 CAGGGAGACCTGGCTATAACAGG + Intronic
907972753 1:59400228-59400250 AAGGGAGATCTGACTACAAAAGG - Intronic
908629514 1:66086984-66087006 GAGAGAGACCTGCATGTACAAGG + Intronic
910371085 1:86515882-86515904 GAGGGAGACTTTTCTCTACATGG - Intergenic
912333997 1:108845706-108845728 GTGGTAGACCTGACTAAACTGGG + Intronic
912605857 1:110987615-110987637 GAGGCAGCCCAGACTATCCAGGG + Intergenic
914449204 1:147775680-147775702 GAGGGAGAGCAGGGTATACAAGG + Intergenic
918880610 1:190114708-190114730 GTGGGAGGCCTAATTATACAGGG - Intronic
924010088 1:239655211-239655233 CTGGGAGACCTTACTATACTTGG - Intronic
1065788076 10:29234804-29234826 GAGTGAGACCTGAATGAACAGGG - Intergenic
1067054529 10:43043163-43043185 CAGGGAGCCCTGACTATGCAAGG + Intergenic
1072525154 10:96264708-96264730 CAGGGAGACCAGACAAGACAGGG + Intronic
1074579142 10:114700529-114700551 GATGGAGAACTTACTCTACATGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1086174517 11:83873852-83873874 GAGGGATACCTAACTGTAAATGG - Intronic
1088201206 11:107337198-107337220 GAGGACTACCTGAATATACAAGG - Intronic
1088789765 11:113214216-113214238 GATGCAGACCTGACTCTCCAAGG - Intronic
1089339634 11:117748753-117748775 CAGGGAGACCTGACCATCTAGGG + Intronic
1098722682 12:73922720-73922742 AATGAAGACCTGACTATGCATGG - Intergenic
1102991624 12:117320324-117320346 GAGGGAGCTCTGACTACAGAAGG + Intronic
1104970078 12:132527175-132527197 GAGGGTGCCCTGGCTAGACAAGG - Intronic
1110052520 13:70922567-70922589 GATGAAGAACTGACTATAAATGG + Intergenic
1110782715 13:79484743-79484765 GAAGGAGGCCTGACTATTAACGG + Intronic
1115151057 14:30286126-30286148 GAGGGAGGCCTGGCAATACGTGG - Intergenic
1119072157 14:71597568-71597590 CAGGGACACCTTCCTATACAAGG - Intronic
1121910717 14:97789965-97789987 GATGGAGAGCTGTCTCTACAAGG - Intergenic
1122673284 14:103388660-103388682 GAGAGGGCACTGACTATACAGGG - Intronic
1125456999 15:39870160-39870182 GAGGGAGATTTGACTACAGAAGG - Intronic
1125479163 15:40068976-40068998 GAGGTACATCTGCCTATACAAGG + Intergenic
1127150570 15:56070691-56070713 GATGGAGGCCTGACAGTACAAGG + Intergenic
1128055753 15:64699069-64699091 GGGGGATTCCTGACTATACTAGG + Intronic
1128391976 15:67188461-67188483 CAGGTAGACCTGACTATATCAGG - Intronic
1128914054 15:71543702-71543724 GAGGGAGACCTGGCTACAGATGG + Intronic
1130103567 15:80912347-80912369 GAGGGAGACCTTGGCATACAGGG - Intronic
1130801289 15:87266276-87266298 AGGGGAGACCTGACTAAATAAGG - Intergenic
1139441153 16:66967937-66967959 GAGGGAGACCTGACTATACACGG - Intronic
1143325046 17:6093157-6093179 GAGGGAGACTGGACTGTACCAGG + Intronic
1144216042 17:13056447-13056469 ACGGGATACCTGACTATAGATGG + Intergenic
1146708044 17:35016394-35016416 GAGAGTGACCCGGCTATACAAGG - Exonic
1149200812 17:54183740-54183762 CAGGGACACCTGACAATACATGG - Intergenic
1152291411 17:79442082-79442104 TTGGGAGACCTGACCATCCACGG + Intronic
1153518983 18:5934287-5934309 GAGGGGAACCTGACTGGACAGGG + Intergenic
1154099705 18:11460233-11460255 GAAGCAGATGTGACTATACAAGG - Intergenic
1155486028 18:26343774-26343796 GACTGAGAACTGAATATACATGG + Intronic
1155586537 18:27372773-27372795 GATGGAGACCTGACTATCAGTGG + Intergenic
1159433085 18:68381502-68381524 GAGGGAGAGGTGGCTATAAAAGG + Intergenic
1159599592 18:70416217-70416239 GAGGGAGACAGGGCTGTACAGGG + Intergenic
1159942590 18:74419906-74419928 GAGGGAGACGTGCTGATACATGG - Intergenic
1160478187 18:79212069-79212091 GAGTAAAACCTGAGTATACAAGG - Intronic
928621294 2:33090878-33090900 GAGGGAAAACTGACTCAACAAGG - Intronic
935113275 2:100111261-100111283 CTGGTAGTCCTGACTATACACGG - Intronic
939111911 2:138018505-138018527 GAAGGGGACCTGATTATAAAAGG + Intergenic
940177354 2:150893347-150893369 GAGGGATAGCTGACTATCCAGGG + Intergenic
943323083 2:186470161-186470183 GAGGGAAAGATGACTTTACATGG + Intergenic
946146101 2:217732175-217732197 ATGGGTGACCTGACAATACAGGG + Intronic
1171051998 20:21868034-21868056 GAGGGAGCACTAAATATACATGG + Intergenic
1173024181 20:39292872-39292894 GATGGAAGCCTGACTCTACAGGG + Intergenic
1176132640 20:63502792-63502814 GAGGCAGACCTGAGTCTACCAGG + Intergenic
1185207847 22:49550323-49550345 GAGGAAGACCAGACCATCCAAGG - Intronic
951617798 3:24567468-24567490 GAGGGACACCTGGCTATATGAGG - Intergenic
954574184 3:51666062-51666084 GAGGCTGACCTGACTAGAGAAGG + Exonic
955395661 3:58555512-58555534 GAGGGAGACCTGAGGATCCCTGG + Intergenic
956144319 3:66176984-66177006 GAGGGAGACTTTACTCTATAGGG - Intronic
958137929 3:89520410-89520432 GAGGGAGACGTAACTATATGAGG + Intergenic
959241486 3:103801333-103801355 GAGGGTGACCTCAATATACCTGG + Intergenic
960527262 3:118724056-118724078 GAGGGAGAACTAAATAAACAAGG + Intergenic
965948356 3:174270757-174270779 GAGGAAGACATGACTGAACATGG + Intronic
975968479 4:80004609-80004631 GAGGGAGATTAGACTATAGATGG - Intronic
976401773 4:84615217-84615239 GGGGTAGAACTGACTAGACATGG - Intronic
976461447 4:85316864-85316886 GAGGGAAACTTGACTGAACAGGG - Intergenic
979633229 4:122926983-122927005 GAGGGACACCTAACTAAATATGG + Intronic
981156600 4:141444080-141444102 GAGAGAAACATGAATATACATGG - Intergenic
983183608 4:164676644-164676666 GAGGGGCACCTGACTATATGAGG - Intergenic
988063107 5:26198760-26198782 AAGGTTGAACTGACTATACAAGG - Intergenic
1000565756 5:162845570-162845592 GAGGTAGGCCTGATTATATATGG - Intergenic
1002624904 5:180519320-180519342 AATGGAGACCTCACTATGCAAGG - Intronic
1003558071 6:7158315-7158337 GAGGGAGACCTGCCTACAAACGG - Intronic
1010855634 6:80834966-80834988 GAGGGAGTCCTCTCTATAAAAGG + Intergenic
1014913108 6:127117567-127117589 GGGGGCGAGCTGACTATAGAGGG + Intergenic
1015458116 6:133452763-133452785 GAGGGGGACCTGACAGTACAAGG + Intronic
1017200594 6:151750022-151750044 GAGGGAGACATGAATATAGATGG + Intronic
1021233217 7:18110579-18110601 GATGGAGTCCTGACTATAAAGGG + Intronic
1025791025 7:64686790-64686812 GAGGGAGAGCAGTCTTTACAGGG - Intronic
1029148556 7:98464262-98464284 GAAAGGGACCTGAATATACAGGG - Intergenic
1030177571 7:106670783-106670805 GAGGGAGATGTGACTATTCAAGG - Intergenic
1031752915 7:125599968-125599990 AAGGGAGATCTGTTTATACATGG - Intergenic
1032811300 7:135420845-135420867 GAGGGAGAACTGGCTACAGAAGG + Intronic
1035114641 7:156514452-156514474 GAGTGAGACAGGACCATACAGGG - Intergenic
1037074552 8:14697891-14697913 GAGGGAGGGCTGACAATAGAGGG - Intronic
1037548124 8:19943457-19943479 GAGGGAGGGCTGAATAAACATGG - Intronic
1041217639 8:55616474-55616496 GAGGGACACTTGACTATATGAGG - Intergenic
1042839819 8:73112312-73112334 GAGGGAAACCTAACCAGACAGGG - Intronic
1044761857 8:95527134-95527156 GAGGGAAATCTTACTTTACAAGG + Intergenic
1045862705 8:106831160-106831182 GGTGAAGACCTGAGTATACACGG + Intergenic
1051049612 9:12915537-12915559 GAGGGAAACATGAGTAGACATGG - Intergenic
1053292457 9:36890355-36890377 GAGGGAGATCTTAGCATACAAGG + Intronic
1057222021 9:93262583-93262605 GAGGGAGAGCTGACTATGCGTGG + Intronic
1057815500 9:98290959-98290981 CAGGGAGACTTGAATAAACAAGG + Intronic
1058414183 9:104768153-104768175 GAGGGAGGGCTGACTATACTAGG + Intronic
1058992870 9:110271295-110271317 GATGGAGACCAGATCATACATGG - Intergenic
1059467929 9:114481166-114481188 GAGGGAGCCCTGGCTAGGCAAGG + Intronic
1186383384 X:9084906-9084928 AAGTGATACCTGACTATATATGG + Intronic
1187235671 X:17464825-17464847 AAGGCAGACCTGGCTATATATGG - Intronic
1188326283 X:28806219-28806241 CAGGGTGACCTGACCATTCATGG + Intronic
1189532153 X:41896231-41896253 GAGGGAAACCTGGCTATTTATGG - Intronic
1191084346 X:56547954-56547976 GAGGGACACCTGCCTATATGAGG - Intergenic
1193641028 X:84009561-84009583 GAGGGGCACCTGACTATATTAGG - Intergenic
1194094829 X:89626453-89626475 GAGGGATAAAAGACTATACACGG - Intergenic
1194430765 X:93801240-93801262 GATGGACACCAGAGTATACATGG - Intergenic
1195252033 X:103058383-103058405 GAGGGACAACTGACTGTACATGG - Intergenic
1196283360 X:113850416-113850438 CAGGGAGACCTGACTTTGGATGG - Intergenic
1197718406 X:129727222-129727244 GAGGTAGACTTGACAAGACATGG + Intergenic